Incidental Mutation 'R5780:Hrh3'
ID 446918
Institutional Source Beutler Lab
Gene Symbol Hrh3
Ensembl Gene ENSMUSG00000039059
Gene Name histamine receptor H3
Synonyms Eae8
MMRRC Submission 043205-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.333) question?
Stock # R5780 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 179741258-179746264 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 179742608 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 308 (V308E)
Ref Sequence ENSEMBL: ENSMUSP00000130553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056480] [ENSMUST00000163215] [ENSMUST00000164442] [ENSMUST00000165248] [ENSMUST00000165762] [ENSMUST00000166724] [ENSMUST00000171736]
AlphaFold P58406
Predicted Effect possibly damaging
Transcript: ENSMUST00000056480
AA Change: V340E

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049963
Gene: ENSMUSG00000039059
AA Change: V340E

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 412 7.2e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163215
AA Change: V308E

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127053
Gene: ENSMUSG00000039059
AA Change: V308E

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 376 2e-55 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164442
AA Change: V308E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130553
Gene: ENSMUSG00000039059
AA Change: V308E

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 380 4.8e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165248
AA Change: V292E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130181
Gene: ENSMUSG00000039059
AA Change: V292E

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 364 6.9e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165762
AA Change: V340E

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132203
Gene: ENSMUSG00000039059
AA Change: V340E

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 412 1.3e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166392
Predicted Effect probably benign
Transcript: ENSMUST00000166724
SMART Domains Protein: ENSMUSP00000126336
Gene: ENSMUSG00000039059

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 93 1.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171736
SMART Domains Protein: ENSMUSP00000127085
Gene: ENSMUSG00000039059

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 239 5.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172211
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. This gene encodes one of the histamine receptors (H3) which belongs to the family 1 of G protein-coupled receptors. It is an integral membrane protein and can regulate neurotransmitter release. This receptor can also increase voltage-dependent calcium current in smooth muscles and innervates the blood vessels and the heart in cardiovascular system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced locomotor activity and body temperature, and attenuated behavioral responses to the drugs thioperamide, methamphetamine, and scopolamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik C T 1: 85,646,039 (GRCm39) A189T probably benign Het
Acsm4 A G 7: 119,293,068 (GRCm39) E66G possibly damaging Het
Afm A G 5: 90,699,290 (GRCm39) E578G possibly damaging Het
Alox5 A T 6: 116,397,310 (GRCm39) D291E probably benign Het
Apoa4 A G 9: 46,153,890 (GRCm39) M164V possibly damaging Het
Atp6v1a A T 16: 43,935,006 (GRCm39) M61K probably benign Het
Avp A G 2: 130,422,629 (GRCm39) S159P probably benign Het
Bicra A T 7: 15,713,679 (GRCm39) L841Q possibly damaging Het
Cdk5rap1 CTT CT 2: 154,187,788 (GRCm39) probably null Het
Clasp2 T G 9: 113,679,220 (GRCm39) L246R probably damaging Het
Dhdds G A 4: 133,724,141 (GRCm39) L58F probably damaging Het
Dmkn A G 7: 30,477,040 (GRCm39) D227G probably damaging Het
Dnah7a G A 1: 53,522,478 (GRCm39) A2920V probably benign Het
Epb41l1 C T 2: 156,338,445 (GRCm39) R163W probably damaging Het
Etfbkmt T A 6: 149,048,657 (GRCm39) Y99N probably damaging Het
Fat4 T C 3: 39,035,104 (GRCm39) Y2919H probably damaging Het
Fcgbp T A 7: 27,784,643 (GRCm39) D234E probably benign Het
Frem1 T C 4: 82,868,652 (GRCm39) D1443G probably benign Het
Fscn2 A C 11: 120,257,494 (GRCm39) E285A probably benign Het
Hmga2 T A 10: 120,298,583 (GRCm39) R79* probably null Het
Hsd11b2 G A 8: 106,248,787 (GRCm39) G93D probably damaging Het
Hydin T C 8: 111,312,712 (GRCm39) F4151S probably damaging Het
Ica1l C A 1: 60,067,374 (GRCm39) E5D probably benign Het
Kcnma1 C A 14: 23,436,419 (GRCm39) E640* probably null Het
Mdn1 C T 4: 32,722,950 (GRCm39) H2422Y probably benign Het
Mgarp T C 3: 51,299,269 (GRCm39) T47A probably damaging Het
Mmp13 T G 9: 7,278,952 (GRCm39) F348V possibly damaging Het
Mov10l1 A G 15: 88,896,181 (GRCm39) D675G probably benign Het
Mtcl2 A G 2: 156,860,410 (GRCm39) C1610R probably damaging Het
Nxpe3 T A 16: 55,686,804 (GRCm39) Q68L probably damaging Het
Or4k41 A T 2: 111,280,178 (GRCm39) D231V probably benign Het
Or6c208 T C 10: 129,223,939 (GRCm39) S146P probably damaging Het
Or7e175 T A 9: 20,048,793 (GRCm39) M127K probably damaging Het
Pald1 A T 10: 61,174,997 (GRCm39) I751N probably damaging Het
Pramel19 C T 4: 101,798,724 (GRCm39) L232F probably damaging Het
Prickle2 T C 6: 92,435,593 (GRCm39) T3A probably benign Het
Ros1 A T 10: 52,070,953 (GRCm39) C34S probably damaging Het
Sema3f A G 9: 107,559,788 (GRCm39) L702P probably damaging Het
Sptbn2 T A 19: 4,774,695 (GRCm39) L116Q probably damaging Het
Stard9 T C 2: 120,533,877 (GRCm39) V3378A probably benign Het
Sycp2l A G 13: 41,282,976 (GRCm39) I158V possibly damaging Het
Tbc1d10b G A 7: 126,797,925 (GRCm39) R739W possibly damaging Het
Tnik T C 3: 28,648,241 (GRCm39) M431T probably benign Het
Ube4b C T 4: 149,415,821 (GRCm39) R1091Q probably benign Het
Vwce C A 19: 10,627,983 (GRCm39) P481Q probably damaging Het
Zfp1005 T A 2: 150,108,139 (GRCm39) M33K probably benign Het
Other mutations in Hrh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Hrh3 APN 2 179,742,896 (GRCm39) missense possibly damaging 0.69
IGL01827:Hrh3 APN 2 179,745,739 (GRCm39) missense possibly damaging 0.95
IGL01912:Hrh3 APN 2 179,743,169 (GRCm39) missense probably damaging 1.00
IGL02992:Hrh3 APN 2 179,742,608 (GRCm39) missense probably benign 0.11
IGL03273:Hrh3 APN 2 179,742,441 (GRCm39) missense possibly damaging 0.85
R1403:Hrh3 UTSW 2 179,744,547 (GRCm39) missense probably damaging 1.00
R1403:Hrh3 UTSW 2 179,744,547 (GRCm39) missense probably damaging 1.00
R1808:Hrh3 UTSW 2 179,741,577 (GRCm39) unclassified probably benign
R2060:Hrh3 UTSW 2 179,743,043 (GRCm39) missense possibly damaging 0.95
R4110:Hrh3 UTSW 2 179,744,643 (GRCm39) missense possibly damaging 0.84
R4111:Hrh3 UTSW 2 179,744,643 (GRCm39) missense possibly damaging 0.84
R4113:Hrh3 UTSW 2 179,744,643 (GRCm39) missense possibly damaging 0.84
R4330:Hrh3 UTSW 2 179,741,665 (GRCm39) unclassified probably benign
R4935:Hrh3 UTSW 2 179,743,061 (GRCm39) missense probably damaging 1.00
R5050:Hrh3 UTSW 2 179,742,350 (GRCm39) missense probably damaging 1.00
R5543:Hrh3 UTSW 2 179,745,763 (GRCm39) missense probably damaging 0.99
R7571:Hrh3 UTSW 2 179,743,079 (GRCm39) missense probably damaging 0.98
R8699:Hrh3 UTSW 2 179,743,149 (GRCm39) missense probably damaging 0.99
R9603:Hrh3 UTSW 2 179,742,444 (GRCm39) nonsense probably null
R9698:Hrh3 UTSW 2 179,743,206 (GRCm39) missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- AAGCTGTAGTGGCACAGTGG -3'
(R):5'- TGCCATTGCACAGGTATGG -3'

Sequencing Primer
(F):5'- AAGCCAGAAGGACGTCTCGTAC -3'
(R):5'- CATTGCACAGGTATGGGGTGG -3'
Posted On 2016-12-15