Incidental Mutation 'R5780:Mgarp'
ID446921
Institutional Source Beutler Lab
Gene Symbol Mgarp
Ensembl Gene ENSMUSG00000037161
Gene Namemitochondria localized glutamic acid rich protein
Synonyms4930583H14Rik, Osap
MMRRC Submission 043205-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5780 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location51388412-51396738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51391848 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 47 (T47A)
Ref Sequence ENSEMBL: ENSMUSP00000103681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038154] [ENSMUST00000108046] [ENSMUST00000141156]
Predicted Effect probably damaging
Transcript: ENSMUST00000038154
AA Change: T55A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040703
Gene: ENSMUSG00000037161
AA Change: T55A

DomainStartEndE-ValueType
Pfam:AIF-MLS 1 185 1.9e-70 PFAM
internal_repeat_1 200 225 3.83e-5 PROSPERO
low complexity region 245 278 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108046
AA Change: T47A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103681
Gene: ENSMUSG00000037161
AA Change: T47A

DomainStartEndE-ValueType
Pfam:AIF-MLS 10 177 7.6e-54 PFAM
low complexity region 237 270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141156
AA Change: T69A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123126
Gene: ENSMUSG00000037161
AA Change: T69A

DomainStartEndE-ValueType
Pfam:AIF-MLS 16 210 3.8e-82 PFAM
internal_repeat_1 214 239 5.25e-5 PROSPERO
low complexity region 259 291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157054
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik C T 1: 85,718,318 A189T probably benign Het
Acsm4 A G 7: 119,693,845 E66G possibly damaging Het
Afm A G 5: 90,551,431 E578G possibly damaging Het
Alox5 A T 6: 116,420,349 D291E probably benign Het
Apoa4 A G 9: 46,242,592 M164V possibly damaging Het
Atp6v1a A T 16: 44,114,643 M61K probably benign Het
Avp A G 2: 130,580,709 S159P probably benign Het
Bicra A T 7: 15,979,754 L841Q possibly damaging Het
Cdk5rap1 CTT CT 2: 154,345,868 probably null Het
Clasp2 T G 9: 113,850,152 L246R probably damaging Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dmkn A G 7: 30,777,615 D227G probably damaging Het
Dnah7a G A 1: 53,483,319 A2920V probably benign Het
Epb41l1 C T 2: 156,496,525 R163W probably damaging Het
Etfbkmt T A 6: 149,147,159 Y99N probably damaging Het
Fat4 T C 3: 38,980,955 Y2919H probably damaging Het
Fcgbp T A 7: 28,085,218 D234E probably benign Het
Frem1 T C 4: 82,950,415 D1443G probably benign Het
Fscn2 A C 11: 120,366,668 E285A probably benign Het
Gm12794 C T 4: 101,941,527 L232F probably damaging Het
Gm14124 T A 2: 150,266,219 M33K probably benign Het
Hmga2 T A 10: 120,462,678 R79* probably null Het
Hrh3 A T 2: 180,100,815 V308E probably damaging Het
Hsd11b2 G A 8: 105,522,155 G93D probably damaging Het
Hydin T C 8: 110,586,080 F4151S probably damaging Het
Ica1l C A 1: 60,028,215 E5D probably benign Het
Kcnma1 C A 14: 23,386,351 E640* probably null Het
Mdn1 C T 4: 32,722,950 H2422Y probably benign Het
Mmp13 T G 9: 7,278,952 F348V possibly damaging Het
Mov10l1 A G 15: 89,011,978 D675G probably benign Het
Nxpe3 T A 16: 55,866,441 Q68L probably damaging Het
Olfr1287 A T 2: 111,449,833 D231V probably benign Het
Olfr784 T C 10: 129,388,070 S146P probably damaging Het
Olfr869 T A 9: 20,137,497 M127K probably damaging Het
Pald1 A T 10: 61,339,218 I751N probably damaging Het
Prickle2 T C 6: 92,458,612 T3A probably benign Het
Ros1 A T 10: 52,194,857 C34S probably damaging Het
Sema3f A G 9: 107,682,589 L702P probably damaging Het
Soga1 A G 2: 157,018,490 C1610R probably damaging Het
Sptbn2 T A 19: 4,724,667 L116Q probably damaging Het
Stard9 T C 2: 120,703,396 V3378A probably benign Het
Sycp2l A G 13: 41,129,500 I158V possibly damaging Het
Tbc1d10b G A 7: 127,198,753 R739W possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Ube4b C T 4: 149,331,364 R1091Q probably benign Het
Vwce C A 19: 10,650,619 P481Q probably damaging Het
Other mutations in Mgarp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01611:Mgarp APN 3 51389149 missense probably damaging 0.99
IGL02145:Mgarp APN 3 51389032 missense possibly damaging 0.79
IGL02736:Mgarp APN 3 51396445 missense possibly damaging 0.89
IGL02824:Mgarp APN 3 51389087 missense probably damaging 0.98
R0117:Mgarp UTSW 3 51396712 unclassified probably benign
R0152:Mgarp UTSW 3 51388963 missense probably benign 0.01
R0492:Mgarp UTSW 3 51389035 missense possibly damaging 0.77
R4433:Mgarp UTSW 3 51396260 intron probably benign
R5048:Mgarp UTSW 3 51391286 missense probably damaging 0.99
R5290:Mgarp UTSW 3 51388966 missense possibly damaging 0.92
R5470:Mgarp UTSW 3 51391285 missense possibly damaging 0.77
R7836:Mgarp UTSW 3 51389066 missense probably benign 0.00
R7903:Mgarp UTSW 3 51396698 missense
R7919:Mgarp UTSW 3 51389066 missense probably benign 0.00
R7986:Mgarp UTSW 3 51396698 missense
Predicted Primers PCR Primer
(F):5'- AATCATGCCCACCATCATGTG -3'
(R):5'- CTGCCTTCCCAGAAGTGAAAATC -3'

Sequencing Primer
(F):5'- GTGAGCTAACCCCCTATTTTTGGAG -3'
(R):5'- TTCCCAGAAGTGAAAATCTCTGACAG -3'
Posted On2016-12-15