Incidental Mutation 'R5780:Afm'
ID446928
Institutional Source Beutler Lab
Gene Symbol Afm
Ensembl Gene ENSMUSG00000029369
Gene Nameafamin
Synonymsalpha albumin, Alf
MMRRC Submission 043205-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5780 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location90518932-90553543 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90551431 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 578 (E578G)
Ref Sequence ENSEMBL: ENSMUSP00000108804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113179] [ENSMUST00000128740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113179
AA Change: E578G

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108804
Gene: ENSMUSG00000029369
AA Change: E578G

DomainStartEndE-ValueType
ALBUMIN 20 205 3.69e-55 SMART
ALBUMIN 212 397 6.42e-64 SMART
ALBUMIN 404 593 3.07e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128740
SMART Domains Protein: ENSMUSP00000117180
Gene: ENSMUSG00000029369

DomainStartEndE-ValueType
ALBUMIN 20 205 3.69e-55 SMART
ALBUMIN 212 397 6.42e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200893
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the albumin gene family, which is comprised of four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The protein encoded by this gene is regulated developmentally, expressed in the liver and secreted into the bloodstream. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik C T 1: 85,718,318 A189T probably benign Het
Acsm4 A G 7: 119,693,845 E66G possibly damaging Het
Alox5 A T 6: 116,420,349 D291E probably benign Het
Apoa4 A G 9: 46,242,592 M164V possibly damaging Het
Atp6v1a A T 16: 44,114,643 M61K probably benign Het
Avp A G 2: 130,580,709 S159P probably benign Het
Bicra A T 7: 15,979,754 L841Q possibly damaging Het
Cdk5rap1 CTT CT 2: 154,345,868 probably null Het
Clasp2 T G 9: 113,850,152 L246R probably damaging Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dmkn A G 7: 30,777,615 D227G probably damaging Het
Dnah7a G A 1: 53,483,319 A2920V probably benign Het
Epb41l1 C T 2: 156,496,525 R163W probably damaging Het
Etfbkmt T A 6: 149,147,159 Y99N probably damaging Het
Fat4 T C 3: 38,980,955 Y2919H probably damaging Het
Fcgbp T A 7: 28,085,218 D234E probably benign Het
Frem1 T C 4: 82,950,415 D1443G probably benign Het
Fscn2 A C 11: 120,366,668 E285A probably benign Het
Gm12794 C T 4: 101,941,527 L232F probably damaging Het
Gm14124 T A 2: 150,266,219 M33K probably benign Het
Hmga2 T A 10: 120,462,678 R79* probably null Het
Hrh3 A T 2: 180,100,815 V308E probably damaging Het
Hsd11b2 G A 8: 105,522,155 G93D probably damaging Het
Hydin T C 8: 110,586,080 F4151S probably damaging Het
Ica1l C A 1: 60,028,215 E5D probably benign Het
Kcnma1 C A 14: 23,386,351 E640* probably null Het
Mdn1 C T 4: 32,722,950 H2422Y probably benign Het
Mgarp T C 3: 51,391,848 T47A probably damaging Het
Mmp13 T G 9: 7,278,952 F348V possibly damaging Het
Mov10l1 A G 15: 89,011,978 D675G probably benign Het
Nxpe3 T A 16: 55,866,441 Q68L probably damaging Het
Olfr1287 A T 2: 111,449,833 D231V probably benign Het
Olfr784 T C 10: 129,388,070 S146P probably damaging Het
Olfr869 T A 9: 20,137,497 M127K probably damaging Het
Pald1 A T 10: 61,339,218 I751N probably damaging Het
Prickle2 T C 6: 92,458,612 T3A probably benign Het
Ros1 A T 10: 52,194,857 C34S probably damaging Het
Sema3f A G 9: 107,682,589 L702P probably damaging Het
Soga1 A G 2: 157,018,490 C1610R probably damaging Het
Sptbn2 T A 19: 4,724,667 L116Q probably damaging Het
Stard9 T C 2: 120,703,396 V3378A probably benign Het
Sycp2l A G 13: 41,129,500 I158V possibly damaging Het
Tbc1d10b G A 7: 127,198,753 R739W possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Ube4b C T 4: 149,331,364 R1091Q probably benign Het
Vwce C A 19: 10,650,619 P481Q probably damaging Het
Other mutations in Afm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Afm APN 5 90525591 missense probably benign 0.01
IGL01140:Afm APN 5 90524867 missense probably damaging 1.00
IGL01789:Afm APN 5 90525584 missense probably benign 0.32
IGL01819:Afm APN 5 90524906 missense probably benign 0.01
IGL01826:Afm APN 5 90524928 splice site probably benign
IGL01875:Afm APN 5 90548883 utr 3 prime probably benign
IGL02337:Afm APN 5 90547911 missense probably benign
IGL02902:Afm APN 5 90526363 missense possibly damaging 0.58
IGL02950:Afm APN 5 90531607 missense probably damaging 1.00
R0009:Afm UTSW 5 90545384 splice site probably benign
R0009:Afm UTSW 5 90545384 splice site probably benign
R0135:Afm UTSW 5 90550322 missense probably benign 0.00
R0582:Afm UTSW 5 90524780 splice site probably benign
R1416:Afm UTSW 5 90526379 missense possibly damaging 0.74
R1465:Afm UTSW 5 90550341 missense probably damaging 1.00
R1465:Afm UTSW 5 90550341 missense probably damaging 1.00
R1834:Afm UTSW 5 90526424 missense probably benign 0.01
R1919:Afm UTSW 5 90524920 nonsense probably null
R2071:Afm UTSW 5 90523735 missense probably benign 0.17
R2843:Afm UTSW 5 90526465 nonsense probably null
R2979:Afm UTSW 5 90522163 missense probably benign 0.19
R4853:Afm UTSW 5 90551467 missense probably damaging 1.00
R5400:Afm UTSW 5 90551398 missense possibly damaging 0.86
R5551:Afm UTSW 5 90531652 missense probably null 0.97
R5583:Afm UTSW 5 90547881 missense probably damaging 1.00
R7378:Afm UTSW 5 90551400 missense probably benign 0.00
R7470:Afm UTSW 5 90531627 missense probably damaging 0.99
R7785:Afm UTSW 5 90550173 missense possibly damaging 0.93
R7799:Afm UTSW 5 90523854 missense probably benign 0.00
R7809:Afm UTSW 5 90524816 missense probably damaging 1.00
R7897:Afm UTSW 5 90547868 missense probably benign 0.00
R7980:Afm UTSW 5 90547868 missense probably benign 0.00
X0022:Afm UTSW 5 90545414 missense probably damaging 1.00
Z1177:Afm UTSW 5 90521946 missense probably benign 0.05
Z1177:Afm UTSW 5 90531506 missense probably benign 0.07
Z1177:Afm UTSW 5 90531616 missense probably damaging 1.00
Z1177:Afm UTSW 5 90551383 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACCAAGTTTGAAACCTAGCATGTG -3'
(R):5'- ACATGGGAAAGCTTCTATTGTGG -3'

Sequencing Primer
(F):5'- AAACCTAGCATGTGTGTCTGTGAC -3'
(R):5'- ATTGTGGACATCTATCGTCTAGC -3'
Posted On2016-12-15