Incidental Mutation 'R5780:Tbc1d10b'
ID446935
Institutional Source Beutler Lab
Gene Symbol Tbc1d10b
Ensembl Gene ENSMUSG00000042492
Gene NameTBC1 domain family, member 10b
Synonyms
MMRRC Submission 043205-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.532) question?
Stock #R5780 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127197459-127208468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127198753 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 739 (R739W)
Ref Sequence ENSEMBL: ENSMUSP00000113307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035771] [ENSMUST00000120705] [ENSMUST00000166791] [ENSMUST00000205316] [ENSMUST00000205321] [ENSMUST00000205355] [ENSMUST00000206026] [ENSMUST00000206081] [ENSMUST00000206587]
Predicted Effect probably benign
Transcript: ENSMUST00000035771
SMART Domains Protein: ENSMUSP00000044790
Gene: ENSMUSG00000042502

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 156 165 N/A INTRINSIC
low complexity region 172 193 N/A INTRINSIC
GYF 282 339 7.35e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120705
AA Change: R739W

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113307
Gene: ENSMUSG00000042492
AA Change: R739W

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 207 227 N/A INTRINSIC
Blast:TBC 274 305 6e-10 BLAST
TBC 343 557 8.23e-57 SMART
low complexity region 632 678 N/A INTRINSIC
coiled coil region 701 769 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153857
Predicted Effect probably benign
Transcript: ENSMUST00000166791
SMART Domains Protein: ENSMUSP00000132963
Gene: ENSMUSG00000042502

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 156 165 N/A INTRINSIC
low complexity region 172 193 N/A INTRINSIC
GYF 282 339 7.35e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205316
Predicted Effect probably benign
Transcript: ENSMUST00000205321
Predicted Effect probably benign
Transcript: ENSMUST00000205355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205525
Predicted Effect probably benign
Transcript: ENSMUST00000205620
Predicted Effect probably benign
Transcript: ENSMUST00000206026
Predicted Effect probably benign
Transcript: ENSMUST00000206081
Predicted Effect probably benign
Transcript: ENSMUST00000206587
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Small G proteins of the RAB family (see MIM 179508) function in intracellular vesicle trafficking by switching from the GTP-bound state to the GDP-bound state with the assistance of guanine nucleotide exchange factors (GEFs; see MIM 609700) and GTPase-activating proteins (GAPs). TBC1D10B functions as a GAP for several proteins of the Rab family (Ishibashi et al., 2009 [PubMed 19077034]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik C T 1: 85,718,318 A189T probably benign Het
Acsm4 A G 7: 119,693,845 E66G possibly damaging Het
Afm A G 5: 90,551,431 E578G possibly damaging Het
Alox5 A T 6: 116,420,349 D291E probably benign Het
Apoa4 A G 9: 46,242,592 M164V possibly damaging Het
Atp6v1a A T 16: 44,114,643 M61K probably benign Het
Avp A G 2: 130,580,709 S159P probably benign Het
Bicra A T 7: 15,979,754 L841Q possibly damaging Het
Cdk5rap1 CTT CT 2: 154,345,868 probably null Het
Clasp2 T G 9: 113,850,152 L246R probably damaging Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dmkn A G 7: 30,777,615 D227G probably damaging Het
Dnah7a G A 1: 53,483,319 A2920V probably benign Het
Epb41l1 C T 2: 156,496,525 R163W probably damaging Het
Etfbkmt T A 6: 149,147,159 Y99N probably damaging Het
Fat4 T C 3: 38,980,955 Y2919H probably damaging Het
Fcgbp T A 7: 28,085,218 D234E probably benign Het
Frem1 T C 4: 82,950,415 D1443G probably benign Het
Fscn2 A C 11: 120,366,668 E285A probably benign Het
Gm12794 C T 4: 101,941,527 L232F probably damaging Het
Gm14124 T A 2: 150,266,219 M33K probably benign Het
Hmga2 T A 10: 120,462,678 R79* probably null Het
Hrh3 A T 2: 180,100,815 V308E probably damaging Het
Hsd11b2 G A 8: 105,522,155 G93D probably damaging Het
Hydin T C 8: 110,586,080 F4151S probably damaging Het
Ica1l C A 1: 60,028,215 E5D probably benign Het
Kcnma1 C A 14: 23,386,351 E640* probably null Het
Mdn1 C T 4: 32,722,950 H2422Y probably benign Het
Mgarp T C 3: 51,391,848 T47A probably damaging Het
Mmp13 T G 9: 7,278,952 F348V possibly damaging Het
Mov10l1 A G 15: 89,011,978 D675G probably benign Het
Nxpe3 T A 16: 55,866,441 Q68L probably damaging Het
Olfr1287 A T 2: 111,449,833 D231V probably benign Het
Olfr784 T C 10: 129,388,070 S146P probably damaging Het
Olfr869 T A 9: 20,137,497 M127K probably damaging Het
Pald1 A T 10: 61,339,218 I751N probably damaging Het
Prickle2 T C 6: 92,458,612 T3A probably benign Het
Ros1 A T 10: 52,194,857 C34S probably damaging Het
Sema3f A G 9: 107,682,589 L702P probably damaging Het
Soga1 A G 2: 157,018,490 C1610R probably damaging Het
Sptbn2 T A 19: 4,724,667 L116Q probably damaging Het
Stard9 T C 2: 120,703,396 V3378A probably benign Het
Sycp2l A G 13: 41,129,500 I158V possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Ube4b C T 4: 149,331,364 R1091Q probably benign Het
Vwce C A 19: 10,650,619 P481Q probably damaging Het
Other mutations in Tbc1d10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Tbc1d10b APN 7 127199081 missense probably damaging 0.97
R0318:Tbc1d10b UTSW 7 127199034 missense probably damaging 1.00
R1480:Tbc1d10b UTSW 7 127203778 missense probably benign
R1793:Tbc1d10b UTSW 7 127203758 missense possibly damaging 0.48
R1971:Tbc1d10b UTSW 7 127207864 missense probably benign 0.37
R2520:Tbc1d10b UTSW 7 127200283 critical splice donor site probably null
R3887:Tbc1d10b UTSW 7 127199795 missense possibly damaging 0.53
R5517:Tbc1d10b UTSW 7 127198607 missense possibly damaging 0.93
R5912:Tbc1d10b UTSW 7 127199861 missense probably damaging 0.99
R6151:Tbc1d10b UTSW 7 127207996 missense probably damaging 1.00
R6358:Tbc1d10b UTSW 7 127203412 missense probably benign 0.02
R6480:Tbc1d10b UTSW 7 127198878 missense probably damaging 0.99
R7075:Tbc1d10b UTSW 7 127203238 missense possibly damaging 0.90
R7731:Tbc1d10b UTSW 7 127198821 missense probably benign
R8004:Tbc1d10b UTSW 7 127199011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAAGTAAGCATCCTGCCG -3'
(R):5'- CTCCCTAGTCTCAAGAGCAGAG -3'

Sequencing Primer
(F):5'- ATCCTGCCGGGCCTCAG -3'
(R):5'- ACCACCTCCTGTCCGCAG -3'
Posted On2016-12-15