Incidental Mutation 'R5780:Hsd11b2'
ID446936
Institutional Source Beutler Lab
Gene Symbol Hsd11b2
Ensembl Gene ENSMUSG00000031891
Gene Namehydroxysteroid 11-beta dehydrogenase 2
Synonyms11HSD2, 11(beta)-HSD2
MMRRC Submission 043205-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5780 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105518755-105523988 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105522155 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 93 (G93D)
Ref Sequence ENSEMBL: ENSMUSP00000034363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013304] [ENSMUST00000034363]
Predicted Effect probably benign
Transcript: ENSMUST00000013304
SMART Domains Protein: ENSMUSP00000013304
Gene: ENSMUSG00000013160

DomainStartEndE-ValueType
Pfam:vATP-synt_AC39 16 347 2.4e-116 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000034363
AA Change: G93D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034363
Gene: ENSMUSG00000031891
AA Change: G93D

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
low complexity region 34 44 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Pfam:adh_short 83 278 9.2e-47 PFAM
Pfam:adh_short_C2 89 294 2e-11 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least two isozymes of the corticosteroid 11-beta-dehydrogenase, a microsomal enzyme complex responsible for the interconversion of cortisol and cortisone. The type I isozyme has both 11-beta-dehydrogenase (cortisol to cortisone) and 11-oxoreductase (cortisone to cortisol) activities. The type II isozyme, encoded by this gene, has only 11-beta-dehydrogenase activity. In aldosterone-selective epithelial tissues such as the kidney, the type II isozyme catalyzes the glucocorticoid cortisol to the inactive metabolite cortisone, thus preventing illicit activation of the mineralocorticoid receptor. In tissues that do not express the mineralocorticoid receptor, such as the placenta and testis, it protects cells from the growth-inhibiting and/or pro-apoptotic effects of cortisol, particularly during embryonic development. Mutations in this gene cause the syndrome of apparent mineralocorticoid excess and hypertension. [provided by RefSeq, Feb 2010]
PHENOTYPE: About half of all mice homozygous for disruptions in this gene die within 48 hours of birth. Survivors are subject to sudden unexplained deaths when between 2 and 4 months of age. They are hypertensive with dilute urine and are hypokalemic and hypochloremic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik C T 1: 85,718,318 A189T probably benign Het
Acsm4 A G 7: 119,693,845 E66G possibly damaging Het
Afm A G 5: 90,551,431 E578G possibly damaging Het
Alox5 A T 6: 116,420,349 D291E probably benign Het
Apoa4 A G 9: 46,242,592 M164V possibly damaging Het
Atp6v1a A T 16: 44,114,643 M61K probably benign Het
Avp A G 2: 130,580,709 S159P probably benign Het
Bicra A T 7: 15,979,754 L841Q possibly damaging Het
Cdk5rap1 CTT CT 2: 154,345,868 probably null Het
Clasp2 T G 9: 113,850,152 L246R probably damaging Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dmkn A G 7: 30,777,615 D227G probably damaging Het
Dnah7a G A 1: 53,483,319 A2920V probably benign Het
Epb41l1 C T 2: 156,496,525 R163W probably damaging Het
Etfbkmt T A 6: 149,147,159 Y99N probably damaging Het
Fat4 T C 3: 38,980,955 Y2919H probably damaging Het
Fcgbp T A 7: 28,085,218 D234E probably benign Het
Frem1 T C 4: 82,950,415 D1443G probably benign Het
Fscn2 A C 11: 120,366,668 E285A probably benign Het
Gm12794 C T 4: 101,941,527 L232F probably damaging Het
Gm14124 T A 2: 150,266,219 M33K probably benign Het
Hmga2 T A 10: 120,462,678 R79* probably null Het
Hrh3 A T 2: 180,100,815 V308E probably damaging Het
Hydin T C 8: 110,586,080 F4151S probably damaging Het
Ica1l C A 1: 60,028,215 E5D probably benign Het
Kcnma1 C A 14: 23,386,351 E640* probably null Het
Mdn1 C T 4: 32,722,950 H2422Y probably benign Het
Mgarp T C 3: 51,391,848 T47A probably damaging Het
Mmp13 T G 9: 7,278,952 F348V possibly damaging Het
Mov10l1 A G 15: 89,011,978 D675G probably benign Het
Nxpe3 T A 16: 55,866,441 Q68L probably damaging Het
Olfr1287 A T 2: 111,449,833 D231V probably benign Het
Olfr784 T C 10: 129,388,070 S146P probably damaging Het
Olfr869 T A 9: 20,137,497 M127K probably damaging Het
Pald1 A T 10: 61,339,218 I751N probably damaging Het
Prickle2 T C 6: 92,458,612 T3A probably benign Het
Ros1 A T 10: 52,194,857 C34S probably damaging Het
Sema3f A G 9: 107,682,589 L702P probably damaging Het
Soga1 A G 2: 157,018,490 C1610R probably damaging Het
Sptbn2 T A 19: 4,724,667 L116Q probably damaging Het
Stard9 T C 2: 120,703,396 V3378A probably benign Het
Sycp2l A G 13: 41,129,500 I158V possibly damaging Het
Tbc1d10b G A 7: 127,198,753 R739W possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Ube4b C T 4: 149,331,364 R1091Q probably benign Het
Vwce C A 19: 10,650,619 P481Q probably damaging Het
Other mutations in Hsd11b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Hsd11b2 APN 8 105523127 missense probably benign 0.06
IGL01620:Hsd11b2 APN 8 105522897 missense probably benign 0.04
IGL02257:Hsd11b2 APN 8 105523222 missense probably benign 0.04
IGL02655:Hsd11b2 APN 8 105522328 missense probably benign 0.00
gilberto UTSW 8 105523067 missense possibly damaging 0.96
R0254:Hsd11b2 UTSW 8 105523067 missense possibly damaging 0.96
R1082:Hsd11b2 UTSW 8 105523151 missense probably damaging 0.99
R2050:Hsd11b2 UTSW 8 105523360 missense probably benign 0.27
R4135:Hsd11b2 UTSW 8 105523166 missense probably benign
R5294:Hsd11b2 UTSW 8 105523297 missense probably benign 0.01
R5598:Hsd11b2 UTSW 8 105522511 missense probably benign
R6058:Hsd11b2 UTSW 8 105523334 missense possibly damaging 0.59
R6867:Hsd11b2 UTSW 8 105522317 missense probably benign 0.00
R7535:Hsd11b2 UTSW 8 105519123 missense probably damaging 0.99
R7786:Hsd11b2 UTSW 8 105518874 missense probably damaging 0.99
R8006:Hsd11b2 UTSW 8 105519103 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACAACTGTCACAGAACTGATGCTC -3'
(R):5'- AGACACATCTGCTGACCAGTG -3'

Sequencing Primer
(F):5'- CTGATGCTCAGGGTTCAGTCAG -3'
(R):5'- CCTTGGTGATTTCCAGAACACGG -3'
Posted On2016-12-15