Incidental Mutation 'R5780:Olfr869'
ID446939
Institutional Source Beutler Lab
Gene Symbol Olfr869
Ensembl Gene ENSMUSG00000058491
Gene Nameolfactory receptor 869
SynonymsMOR145-6, GA_x6K02T2PVTD-13878275-13879204
MMRRC Submission 043205-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5780 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location20129009-20138763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20137497 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 127 (M127K)
Ref Sequence ENSEMBL: ENSMUSP00000154723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075717] [ENSMUST00000213024]
Predicted Effect probably damaging
Transcript: ENSMUST00000075717
AA Change: M127K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075135
Gene: ENSMUSG00000049028
AA Change: M127K

DomainStartEndE-ValueType
Pfam:7tm_4 45 321 6.2e-43 PFAM
Pfam:7TM_GPCR_Srsx 49 309 3e-8 PFAM
Pfam:7tm_1 55 304 1.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212969
Predicted Effect probably damaging
Transcript: ENSMUST00000213024
AA Change: M127K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik C T 1: 85,718,318 A189T probably benign Het
Acsm4 A G 7: 119,693,845 E66G possibly damaging Het
Afm A G 5: 90,551,431 E578G possibly damaging Het
Alox5 A T 6: 116,420,349 D291E probably benign Het
Apoa4 A G 9: 46,242,592 M164V possibly damaging Het
Atp6v1a A T 16: 44,114,643 M61K probably benign Het
Avp A G 2: 130,580,709 S159P probably benign Het
Bicra A T 7: 15,979,754 L841Q possibly damaging Het
Cdk5rap1 CTT CT 2: 154,345,868 probably null Het
Clasp2 T G 9: 113,850,152 L246R probably damaging Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dmkn A G 7: 30,777,615 D227G probably damaging Het
Dnah7a G A 1: 53,483,319 A2920V probably benign Het
Epb41l1 C T 2: 156,496,525 R163W probably damaging Het
Etfbkmt T A 6: 149,147,159 Y99N probably damaging Het
Fat4 T C 3: 38,980,955 Y2919H probably damaging Het
Fcgbp T A 7: 28,085,218 D234E probably benign Het
Frem1 T C 4: 82,950,415 D1443G probably benign Het
Fscn2 A C 11: 120,366,668 E285A probably benign Het
Gm12794 C T 4: 101,941,527 L232F probably damaging Het
Gm14124 T A 2: 150,266,219 M33K probably benign Het
Hmga2 T A 10: 120,462,678 R79* probably null Het
Hrh3 A T 2: 180,100,815 V308E probably damaging Het
Hsd11b2 G A 8: 105,522,155 G93D probably damaging Het
Hydin T C 8: 110,586,080 F4151S probably damaging Het
Ica1l C A 1: 60,028,215 E5D probably benign Het
Kcnma1 C A 14: 23,386,351 E640* probably null Het
Mdn1 C T 4: 32,722,950 H2422Y probably benign Het
Mgarp T C 3: 51,391,848 T47A probably damaging Het
Mmp13 T G 9: 7,278,952 F348V possibly damaging Het
Mov10l1 A G 15: 89,011,978 D675G probably benign Het
Nxpe3 T A 16: 55,866,441 Q68L probably damaging Het
Olfr1287 A T 2: 111,449,833 D231V probably benign Het
Olfr784 T C 10: 129,388,070 S146P probably damaging Het
Pald1 A T 10: 61,339,218 I751N probably damaging Het
Prickle2 T C 6: 92,458,612 T3A probably benign Het
Ros1 A T 10: 52,194,857 C34S probably damaging Het
Sema3f A G 9: 107,682,589 L702P probably damaging Het
Soga1 A G 2: 157,018,490 C1610R probably damaging Het
Sptbn2 T A 19: 4,724,667 L116Q probably damaging Het
Stard9 T C 2: 120,703,396 V3378A probably benign Het
Sycp2l A G 13: 41,129,500 I158V possibly damaging Het
Tbc1d10b G A 7: 127,198,753 R739W possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Ube4b C T 4: 149,331,364 R1091Q probably benign Het
Vwce C A 19: 10,650,619 P481Q probably damaging Het
Other mutations in Olfr869
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Olfr869 APN 9 20137235 missense probably benign
IGL01550:Olfr869 APN 9 20137454 missense probably damaging 0.97
IGL02247:Olfr869 APN 9 20137220 missense probably benign 0.01
IGL02448:Olfr869 APN 9 20137641 nonsense probably null
IGL03076:Olfr869 APN 9 20137727 missense probably benign 0.25
R0045:Olfr869 UTSW 9 20137191 missense probably benign 0.25
R0962:Olfr869 UTSW 9 20137538 missense probably damaging 1.00
R4588:Olfr869 UTSW 9 20138087 makesense probably null
R4931:Olfr869 UTSW 9 20137562 missense probably benign 0.19
R5030:Olfr869 UTSW 9 20138067 missense probably benign 0.01
R5759:Olfr869 UTSW 9 20137932 missense probably benign 0.12
R6440:Olfr869 UTSW 9 20137194 missense probably damaging 1.00
R6599:Olfr869 UTSW 9 20137943 missense probably damaging 1.00
R6710:Olfr869 UTSW 9 20138082 missense probably benign 0.01
R6953:Olfr869 UTSW 9 20138003 missense probably benign 0.00
R7288:Olfr869 UTSW 9 20137441 nonsense probably null
R7585:Olfr869 UTSW 9 20129011
R7860:Olfr869 UTSW 9 20137575 missense probably benign 0.16
R7943:Olfr869 UTSW 9 20137575 missense probably benign 0.16
R8025:Olfr869 UTSW 9 20137632 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACAGTGCTTGGAAACCTGC -3'
(R):5'- CCACTGAAGTGTGTAAATTGTAGC -3'

Sequencing Primer
(F):5'- GGAAACCTGCTCATCATTCTGG -3'
(R):5'- GACTGGCCAAAACAGATG -3'
Posted On2016-12-15