Incidental Mutation 'R5780:Apoa4'
ID446940
Institutional Source Beutler Lab
Gene Symbol Apoa4
Ensembl Gene ENSMUSG00000032080
Gene Nameapolipoprotein A-IV
SynonymsApoa-4
MMRRC Submission 043205-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5780 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location46240696-46243459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46242592 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 164 (M164V)
Ref Sequence ENSEMBL: ENSMUSP00000034585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034585]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034585
AA Change: M164V

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034585
Gene: ENSMUSG00000032080
AA Change: M164V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Apolipoprotein 61 213 1.1e-33 PFAM
Pfam:Apolipoprotein 182 338 9.1e-29 PFAM
Pfam:Apolipoprotein 298 390 7.4e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215445
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoliprotein (apo) A-IV gene contains 3 exons separated by two introns. A sequence polymorphism has been identified in the 3'UTR of the third exon. The primary translation product is a 396-residue preprotein which after proteolytic processing is secreted its primary site of synthesis, the intestine, in association with chylomicron particles. Although its precise function is not known, apo A-IV is a potent activator of lecithin-cholesterol acyltransferase in vitro. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene have lower HDL cholesterol levels but normal lipid absorption, growth, and feeding behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik C T 1: 85,718,318 A189T probably benign Het
Acsm4 A G 7: 119,693,845 E66G possibly damaging Het
Afm A G 5: 90,551,431 E578G possibly damaging Het
Alox5 A T 6: 116,420,349 D291E probably benign Het
Atp6v1a A T 16: 44,114,643 M61K probably benign Het
Avp A G 2: 130,580,709 S159P probably benign Het
Bicra A T 7: 15,979,754 L841Q possibly damaging Het
Cdk5rap1 CTT CT 2: 154,345,868 probably null Het
Clasp2 T G 9: 113,850,152 L246R probably damaging Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dmkn A G 7: 30,777,615 D227G probably damaging Het
Dnah7a G A 1: 53,483,319 A2920V probably benign Het
Epb41l1 C T 2: 156,496,525 R163W probably damaging Het
Etfbkmt T A 6: 149,147,159 Y99N probably damaging Het
Fat4 T C 3: 38,980,955 Y2919H probably damaging Het
Fcgbp T A 7: 28,085,218 D234E probably benign Het
Frem1 T C 4: 82,950,415 D1443G probably benign Het
Fscn2 A C 11: 120,366,668 E285A probably benign Het
Gm12794 C T 4: 101,941,527 L232F probably damaging Het
Gm14124 T A 2: 150,266,219 M33K probably benign Het
Hmga2 T A 10: 120,462,678 R79* probably null Het
Hrh3 A T 2: 180,100,815 V308E probably damaging Het
Hsd11b2 G A 8: 105,522,155 G93D probably damaging Het
Hydin T C 8: 110,586,080 F4151S probably damaging Het
Ica1l C A 1: 60,028,215 E5D probably benign Het
Kcnma1 C A 14: 23,386,351 E640* probably null Het
Mdn1 C T 4: 32,722,950 H2422Y probably benign Het
Mgarp T C 3: 51,391,848 T47A probably damaging Het
Mmp13 T G 9: 7,278,952 F348V possibly damaging Het
Mov10l1 A G 15: 89,011,978 D675G probably benign Het
Nxpe3 T A 16: 55,866,441 Q68L probably damaging Het
Olfr1287 A T 2: 111,449,833 D231V probably benign Het
Olfr784 T C 10: 129,388,070 S146P probably damaging Het
Olfr869 T A 9: 20,137,497 M127K probably damaging Het
Pald1 A T 10: 61,339,218 I751N probably damaging Het
Prickle2 T C 6: 92,458,612 T3A probably benign Het
Ros1 A T 10: 52,194,857 C34S probably damaging Het
Sema3f A G 9: 107,682,589 L702P probably damaging Het
Soga1 A G 2: 157,018,490 C1610R probably damaging Het
Sptbn2 T A 19: 4,724,667 L116Q probably damaging Het
Stard9 T C 2: 120,703,396 V3378A probably benign Het
Sycp2l A G 13: 41,129,500 I158V possibly damaging Het
Tbc1d10b G A 7: 127,198,753 R739W possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Ube4b C T 4: 149,331,364 R1091Q probably benign Het
Vwce C A 19: 10,650,619 P481Q probably damaging Het
Other mutations in Apoa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Apoa4 APN 9 46242985 missense probably benign 0.30
IGL02321:Apoa4 APN 9 46242920 missense probably damaging 0.98
R0001:Apoa4 UTSW 9 46242892 missense probably benign 0.03
R0054:Apoa4 UTSW 9 46242524 missense probably benign 0.00
R0054:Apoa4 UTSW 9 46242524 missense probably benign 0.00
R0401:Apoa4 UTSW 9 46243058 missense probably damaging 1.00
R1446:Apoa4 UTSW 9 46242293 missense probably benign 0.03
R2027:Apoa4 UTSW 9 46243000 missense probably damaging 1.00
R2332:Apoa4 UTSW 9 46242355 missense probably benign 0.00
R4979:Apoa4 UTSW 9 46241505 missense probably benign 0.01
R5120:Apoa4 UTSW 9 46242737 missense probably damaging 1.00
R6769:Apoa4 UTSW 9 46243167 missense probably benign 0.01
R6771:Apoa4 UTSW 9 46243167 missense probably benign 0.01
R7009:Apoa4 UTSW 9 46242880 missense possibly damaging 0.82
R7384:Apoa4 UTSW 9 46241474 missense not run
R7625:Apoa4 UTSW 9 46243112 missense probably damaging 0.99
R8039:Apoa4 UTSW 9 46242293 missense possibly damaging 0.70
Z1176:Apoa4 UTSW 9 46242589 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACAGCTGAGTGGGCATCTAG -3'
(R):5'- ATGGTTGAGTTTCTCCTGCACG -3'

Sequencing Primer
(F):5'- CAAGAAGGAGCTGGAGGACCTAC -3'
(R):5'- ACCGTCAGAGGGGCCAG -3'
Posted On2016-12-15