Incidental Mutation 'R5780:Mov10l1'
ID446950
Institutional Source Beutler Lab
Gene Symbol Mov10l1
Ensembl Gene ENSMUSG00000015365
Gene NameMoloney leukemia virus 10-like 1
SynonymsCsm, CHAMP
MMRRC Submission 043205-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R5780 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location88982909-89055152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89011978 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 675 (D675G)
Ref Sequence ENSEMBL: ENSMUSP00000118437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015509] [ENSMUST00000146993]
Predicted Effect probably benign
Transcript: ENSMUST00000015509
AA Change: D623G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000015509
Gene: ENSMUSG00000015365
AA Change: D623G

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
Blast:AAA 444 526 2e-7 BLAST
internal_repeat_1 615 651 5.23e-10 PROSPERO
internal_repeat_1 648 696 5.23e-10 PROSPERO
Pfam:AAA_11 746 852 1.4e-17 PFAM
Pfam:AAA_30 746 933 5e-11 PFAM
Pfam:AAA_19 754 826 1.5e-10 PFAM
Pfam:AAA_11 855 928 1.3e-18 PFAM
Pfam:AAA_12 935 1152 3.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146993
AA Change: D675G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118437
Gene: ENSMUSG00000015365
AA Change: D675G

DomainStartEndE-ValueType
low complexity region 104 117 N/A INTRINSIC
low complexity region 390 401 N/A INTRINSIC
Blast:AAA 496 578 2e-7 BLAST
internal_repeat_1 667 703 6.08e-10 PROSPERO
internal_repeat_1 700 748 6.08e-10 PROSPERO
Pfam:AAA_11 798 903 1e-15 PFAM
Pfam:AAA_30 798 985 1.8e-11 PFAM
Pfam:AAA_19 806 878 7e-11 PFAM
Pfam:AAA_11 907 980 3.2e-17 PFAM
Pfam:AAA_12 987 1204 1.4e-43 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a putative RNA helicase and shows testis-specific expression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a targeted allele lacking the helicase domain exhibit male infertility due to meiotic arrest, apoptosis, and derepression of retrotransposons in male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik C T 1: 85,718,318 A189T probably benign Het
Acsm4 A G 7: 119,693,845 E66G possibly damaging Het
Afm A G 5: 90,551,431 E578G possibly damaging Het
Alox5 A T 6: 116,420,349 D291E probably benign Het
Apoa4 A G 9: 46,242,592 M164V possibly damaging Het
Atp6v1a A T 16: 44,114,643 M61K probably benign Het
Avp A G 2: 130,580,709 S159P probably benign Het
Bicra A T 7: 15,979,754 L841Q possibly damaging Het
Cdk5rap1 CTT CT 2: 154,345,868 probably null Het
Clasp2 T G 9: 113,850,152 L246R probably damaging Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dmkn A G 7: 30,777,615 D227G probably damaging Het
Dnah7a G A 1: 53,483,319 A2920V probably benign Het
Epb41l1 C T 2: 156,496,525 R163W probably damaging Het
Etfbkmt T A 6: 149,147,159 Y99N probably damaging Het
Fat4 T C 3: 38,980,955 Y2919H probably damaging Het
Fcgbp T A 7: 28,085,218 D234E probably benign Het
Frem1 T C 4: 82,950,415 D1443G probably benign Het
Fscn2 A C 11: 120,366,668 E285A probably benign Het
Gm12794 C T 4: 101,941,527 L232F probably damaging Het
Gm14124 T A 2: 150,266,219 M33K probably benign Het
Hmga2 T A 10: 120,462,678 R79* probably null Het
Hrh3 A T 2: 180,100,815 V308E probably damaging Het
Hsd11b2 G A 8: 105,522,155 G93D probably damaging Het
Hydin T C 8: 110,586,080 F4151S probably damaging Het
Ica1l C A 1: 60,028,215 E5D probably benign Het
Kcnma1 C A 14: 23,386,351 E640* probably null Het
Mdn1 C T 4: 32,722,950 H2422Y probably benign Het
Mgarp T C 3: 51,391,848 T47A probably damaging Het
Mmp13 T G 9: 7,278,952 F348V possibly damaging Het
Nxpe3 T A 16: 55,866,441 Q68L probably damaging Het
Olfr1287 A T 2: 111,449,833 D231V probably benign Het
Olfr784 T C 10: 129,388,070 S146P probably damaging Het
Olfr869 T A 9: 20,137,497 M127K probably damaging Het
Pald1 A T 10: 61,339,218 I751N probably damaging Het
Prickle2 T C 6: 92,458,612 T3A probably benign Het
Ros1 A T 10: 52,194,857 C34S probably damaging Het
Sema3f A G 9: 107,682,589 L702P probably damaging Het
Soga1 A G 2: 157,018,490 C1610R probably damaging Het
Sptbn2 T A 19: 4,724,667 L116Q probably damaging Het
Stard9 T C 2: 120,703,396 V3378A probably benign Het
Sycp2l A G 13: 41,129,500 I158V possibly damaging Het
Tbc1d10b G A 7: 127,198,753 R739W possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Ube4b C T 4: 149,331,364 R1091Q probably benign Het
Vwce C A 19: 10,650,619 P481Q probably damaging Het
Other mutations in Mov10l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Mov10l1 APN 15 88994989 missense probably damaging 1.00
IGL01110:Mov10l1 APN 15 89021257 missense probably benign 0.05
IGL01369:Mov10l1 APN 15 89024837 splice site probably benign
IGL01531:Mov10l1 APN 15 89054352 missense probably damaging 0.99
IGL01712:Mov10l1 APN 15 89024766 missense probably damaging 0.98
IGL02330:Mov10l1 APN 15 89026490 missense probably damaging 1.00
IGL02540:Mov10l1 APN 15 89018211 missense probably benign
IGL02938:Mov10l1 APN 15 88988526 missense probably damaging 1.00
R0382:Mov10l1 UTSW 15 88985593 missense possibly damaging 0.96
R0437:Mov10l1 UTSW 15 89005312 missense probably damaging 0.96
R0504:Mov10l1 UTSW 15 88998839 missense probably damaging 1.00
R0538:Mov10l1 UTSW 15 88994860 missense possibly damaging 0.73
R0577:Mov10l1 UTSW 15 89005727 missense probably damaging 1.00
R0592:Mov10l1 UTSW 15 88998766 critical splice acceptor site probably null
R0972:Mov10l1 UTSW 15 89021279 missense probably damaging 0.99
R1386:Mov10l1 UTSW 15 89011386 missense possibly damaging 0.87
R1737:Mov10l1 UTSW 15 89011404 missense possibly damaging 0.79
R2120:Mov10l1 UTSW 15 89007627 missense probably benign 0.30
R3740:Mov10l1 UTSW 15 89012142 missense possibly damaging 0.92
R3741:Mov10l1 UTSW 15 89012142 missense possibly damaging 0.92
R3846:Mov10l1 UTSW 15 89012142 missense possibly damaging 0.92
R3850:Mov10l1 UTSW 15 89005695 critical splice acceptor site probably null
R3964:Mov10l1 UTSW 15 89012163 missense probably benign 0.00
R3965:Mov10l1 UTSW 15 89012163 missense probably benign 0.00
R4049:Mov10l1 UTSW 15 88995032 splice site probably benign
R4836:Mov10l1 UTSW 15 89020269 missense possibly damaging 0.47
R5233:Mov10l1 UTSW 15 88983032 missense probably benign
R5466:Mov10l1 UTSW 15 88985701 critical splice donor site probably null
R5552:Mov10l1 UTSW 15 89054366 critical splice donor site probably null
R6275:Mov10l1 UTSW 15 89026620 missense probably damaging 0.99
R6326:Mov10l1 UTSW 15 88994895 missense probably damaging 1.00
R6652:Mov10l1 UTSW 15 88993902 missense probably damaging 1.00
R6793:Mov10l1 UTSW 15 88996184 missense possibly damaging 0.86
R7278:Mov10l1 UTSW 15 88993868 missense probably benign 0.18
R7733:Mov10l1 UTSW 15 89024801 missense probably damaging 0.99
R7998:Mov10l1 UTSW 15 89053439 missense probably damaging 1.00
Z1177:Mov10l1 UTSW 15 88996136 missense probably benign 0.36
Z1177:Mov10l1 UTSW 15 89018168 missense probably damaging 0.99
Z1177:Mov10l1 UTSW 15 89053411 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTGAACTGTTTCAGAACCAGC -3'
(R):5'- ACATTGGTGATGGACTGGC -3'

Sequencing Primer
(F):5'- GTGAACTGTTTCAGAACCAGCTATAG -3'
(R):5'- GACTGGCTGTCATTTCTGGTTACC -3'
Posted On2016-12-15