Incidental Mutation 'R5780:Vwce'
ID446954
Institutional Source Beutler Lab
Gene Symbol Vwce
Ensembl Gene ENSMUSG00000043789
Gene Namevon Willebrand factor C and EGF domains
Synonyms1300015B04Rik
MMRRC Submission 043205-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5780 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10634233-10665210 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 10650619 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 481 (P481Q)
Ref Sequence ENSEMBL: ENSMUSP00000056958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055115]
Predicted Effect probably damaging
Transcript: ENSMUST00000055115
AA Change: P481Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000056958
Gene: ENSMUSG00000043789
AA Change: P481Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 70 98 2.2e1 SMART
EGF_CA 142 180 6.91e-9 SMART
EGF_CA 181 219 7.75e-12 SMART
EGF_CA 220 262 1.11e-12 SMART
low complexity region 294 312 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
VWC 378 432 2.91e-6 SMART
VWC 435 488 4.58e-4 SMART
VWC 493 551 2.06e-6 SMART
VWC 560 617 9.74e-8 SMART
VWC 621 676 1.35e-10 SMART
VWC 679 725 2.58e-1 SMART
low complexity region 761 772 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik C T 1: 85,718,318 A189T probably benign Het
Acsm4 A G 7: 119,693,845 E66G possibly damaging Het
Afm A G 5: 90,551,431 E578G possibly damaging Het
Alox5 A T 6: 116,420,349 D291E probably benign Het
Apoa4 A G 9: 46,242,592 M164V possibly damaging Het
Atp6v1a A T 16: 44,114,643 M61K probably benign Het
Avp A G 2: 130,580,709 S159P probably benign Het
Bicra A T 7: 15,979,754 L841Q possibly damaging Het
Cdk5rap1 CTT CT 2: 154,345,868 probably null Het
Clasp2 T G 9: 113,850,152 L246R probably damaging Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dmkn A G 7: 30,777,615 D227G probably damaging Het
Dnah7a G A 1: 53,483,319 A2920V probably benign Het
Epb41l1 C T 2: 156,496,525 R163W probably damaging Het
Etfbkmt T A 6: 149,147,159 Y99N probably damaging Het
Fat4 T C 3: 38,980,955 Y2919H probably damaging Het
Fcgbp T A 7: 28,085,218 D234E probably benign Het
Frem1 T C 4: 82,950,415 D1443G probably benign Het
Fscn2 A C 11: 120,366,668 E285A probably benign Het
Gm12794 C T 4: 101,941,527 L232F probably damaging Het
Gm14124 T A 2: 150,266,219 M33K probably benign Het
Hmga2 T A 10: 120,462,678 R79* probably null Het
Hrh3 A T 2: 180,100,815 V308E probably damaging Het
Hsd11b2 G A 8: 105,522,155 G93D probably damaging Het
Hydin T C 8: 110,586,080 F4151S probably damaging Het
Ica1l C A 1: 60,028,215 E5D probably benign Het
Kcnma1 C A 14: 23,386,351 E640* probably null Het
Mdn1 C T 4: 32,722,950 H2422Y probably benign Het
Mgarp T C 3: 51,391,848 T47A probably damaging Het
Mmp13 T G 9: 7,278,952 F348V possibly damaging Het
Mov10l1 A G 15: 89,011,978 D675G probably benign Het
Nxpe3 T A 16: 55,866,441 Q68L probably damaging Het
Olfr1287 A T 2: 111,449,833 D231V probably benign Het
Olfr784 T C 10: 129,388,070 S146P probably damaging Het
Olfr869 T A 9: 20,137,497 M127K probably damaging Het
Pald1 A T 10: 61,339,218 I751N probably damaging Het
Prickle2 T C 6: 92,458,612 T3A probably benign Het
Ros1 A T 10: 52,194,857 C34S probably damaging Het
Sema3f A G 9: 107,682,589 L702P probably damaging Het
Soga1 A G 2: 157,018,490 C1610R probably damaging Het
Sptbn2 T A 19: 4,724,667 L116Q probably damaging Het
Stard9 T C 2: 120,703,396 V3378A probably benign Het
Sycp2l A G 13: 41,129,500 I158V possibly damaging Het
Tbc1d10b G A 7: 127,198,753 R739W possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Ube4b C T 4: 149,331,364 R1091Q probably benign Het
Other mutations in Vwce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Vwce APN 19 10664511 unclassified probably null
IGL01358:Vwce APN 19 10664409 missense possibly damaging 0.86
IGL02330:Vwce APN 19 10646801 missense possibly damaging 0.96
IGL02477:Vwce APN 19 10664618 unclassified probably null
IGL02551:Vwce APN 19 10645036 missense possibly damaging 0.71
IGL02606:Vwce APN 19 10655348 splice site probably benign
IGL02633:Vwce APN 19 10648494 missense probably damaging 0.98
IGL02656:Vwce APN 19 10664352 missense probably benign
IGL02884:Vwce APN 19 10646579 missense possibly damaging 0.53
IGL02973:Vwce APN 19 10655400 nonsense probably null
IGL03038:Vwce APN 19 10646671 missense possibly damaging 0.86
IGL03329:Vwce APN 19 10659996 missense possibly damaging 0.73
PIT4403001:Vwce UTSW 19 10638097 missense possibly damaging 0.53
PIT4431001:Vwce UTSW 19 10664582 missense possibly damaging 0.53
PIT4519001:Vwce UTSW 19 10664582 missense possibly damaging 0.53
R0042:Vwce UTSW 19 10646813 missense probably benign
R0081:Vwce UTSW 19 10664089 critical splice acceptor site probably null
R0142:Vwce UTSW 19 10664612 missense probably damaging 0.97
R0165:Vwce UTSW 19 10659973 splice site probably benign
R0948:Vwce UTSW 19 10653077 missense probably damaging 1.00
R1053:Vwce UTSW 19 10664099 missense probably benign 0.18
R1505:Vwce UTSW 19 10664244 missense probably benign
R1623:Vwce UTSW 19 10646744 nonsense probably null
R1672:Vwce UTSW 19 10653095 missense possibly damaging 0.92
R1882:Vwce UTSW 19 10638156 missense possibly damaging 0.53
R3849:Vwce UTSW 19 10646905 missense probably damaging 0.97
R4292:Vwce UTSW 19 10659632 missense probably benign 0.00
R4293:Vwce UTSW 19 10659632 missense probably benign 0.00
R4531:Vwce UTSW 19 10664346 missense probably benign 0.01
R4678:Vwce UTSW 19 10664648 missense possibly damaging 0.86
R4720:Vwce UTSW 19 10648467 missense possibly damaging 0.85
R4737:Vwce UTSW 19 10650579 missense probably benign 0.33
R4864:Vwce UTSW 19 10650636 missense probably benign 0.01
R4916:Vwce UTSW 19 10646879 missense probably damaging 0.98
R4939:Vwce UTSW 19 10645050 missense probably damaging 0.98
R5605:Vwce UTSW 19 10658038 missense possibly damaging 0.95
R5735:Vwce UTSW 19 10647067 missense probably benign 0.08
R6158:Vwce UTSW 19 10644221 missense possibly damaging 0.91
R6383:Vwce UTSW 19 10659592 nonsense probably null
R6920:Vwce UTSW 19 10664693 missense probably benign
R7201:Vwce UTSW 19 10638115 missense possibly damaging 0.72
R7276:Vwce UTSW 19 10664174 missense possibly damaging 0.53
R7423:Vwce UTSW 19 10664340 missense probably benign 0.02
R7474:Vwce UTSW 19 10646941 missense possibly damaging 0.93
R7843:Vwce UTSW 19 10664283 missense probably benign 0.01
R7926:Vwce UTSW 19 10664283 missense probably benign 0.01
RF020:Vwce UTSW 19 10653085 missense probably damaging 1.00
X0018:Vwce UTSW 19 10656662 missense possibly damaging 0.86
Z1177:Vwce UTSW 19 10646863 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGCTCCAAGAGGACCTTCC -3'
(R):5'- GAGCACAGTGTGGCCGAG -3'

Sequencing Primer
(F):5'- CTGGCCTGAAACTTGCAATG -3'
(R):5'- TGGCCGAGGTGCACAGAG -3'
Posted On2016-12-15