Incidental Mutation 'R5791:Gmppa'
ID446955
Institutional Source Beutler Lab
Gene Symbol Gmppa
Ensembl Gene ENSMUSG00000033021
Gene NameGDP-mannose pyrophosphorylase A
Synonyms
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.449) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75435930-75443179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75442255 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 324 (V324A)
Ref Sequence ENSEMBL: ENSMUSP00000109214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037796] [ENSMUST00000113584] [ENSMUST00000131545] [ENSMUST00000133418] [ENSMUST00000140287] [ENSMUST00000141124] [ENSMUST00000143730] [ENSMUST00000144874] [ENSMUST00000145166] [ENSMUST00000188097]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037796
AA Change: V324A

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035564
Gene: ENSMUSG00000033021
AA Change: V324A

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 1.2e-30 PFAM
Pfam:NTP_transf_3 4 206 4.1e-10 PFAM
Pfam:Hexapep 280 321 2.6e-8 PFAM
low complexity region 357 365 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113584
AA Change: V324A

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109214
Gene: ENSMUSG00000033021
AA Change: V324A

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 1.6e-28 PFAM
Pfam:NTP_transf_3 4 206 1.6e-9 PFAM
Pfam:Hexapep 286 321 4.3e-8 PFAM
low complexity region 357 365 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124539
Predicted Effect probably benign
Transcript: ENSMUST00000131545
SMART Domains Protein: ENSMUSP00000120841
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 7.2e-31 PFAM
Pfam:NTP_transf_3 4 157 1.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132291
Predicted Effect probably benign
Transcript: ENSMUST00000133418
SMART Domains Protein: ENSMUSP00000122443
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 6.8e-31 PFAM
Pfam:NTP_transf_3 4 204 1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135453
Predicted Effect probably benign
Transcript: ENSMUST00000140287
SMART Domains Protein: ENSMUSP00000121552
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 161 1.7e-22 PFAM
Pfam:NTP_transf_3 4 155 6.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141124
SMART Domains Protein: ENSMUSP00000116783
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 72 1.1e-13 PFAM
Pfam:NTP_transf_3 4 71 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143730
SMART Domains Protein: ENSMUSP00000114375
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 196 1.1e-30 PFAM
Pfam:NTP_transf_3 4 173 9.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144874
SMART Domains Protein: ENSMUSP00000121418
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 1 174 6.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145166
SMART Domains Protein: ENSMUSP00000116754
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 91 5.2e-15 PFAM
Pfam:NTP_transf_3 4 88 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188097
SMART Domains Protein: ENSMUSP00000139936
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 1 150 2.3e-15 PFAM
Pfam:NTP_transf_3 2 142 9.8e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to encode a GDP-mannose pyrophosphorylase. This enzyme catalyzes the reaction which converts mannose-1-phosphate and GTP to GDP-mannose which is involved in the production of N-linked oligosaccharides. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gstm2 C T 3: 107,984,128 probably null Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Gmppa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01871:Gmppa APN 1 75437017 missense probably damaging 0.98
IGL02418:Gmppa APN 1 75439020 missense probably damaging 1.00
IGL02899:Gmppa APN 1 75441830 splice site probably null
IGL03009:Gmppa APN 1 75439370 missense probably damaging 1.00
PIT4151001:Gmppa UTSW 1 75441824 nonsense probably null
R0708:Gmppa UTSW 1 75442574 missense probably damaging 1.00
R1352:Gmppa UTSW 1 75440534 missense probably benign 0.00
R1886:Gmppa UTSW 1 75442508 missense probably damaging 1.00
R2000:Gmppa UTSW 1 75441528 missense probably damaging 1.00
R3053:Gmppa UTSW 1 75441756 missense probably benign 0.04
R4301:Gmppa UTSW 1 75442496 missense possibly damaging 0.77
R5054:Gmppa UTSW 1 75439371 nonsense probably null
R6801:Gmppa UTSW 1 75441747 missense possibly damaging 0.94
R7806:Gmppa UTSW 1 75438937 missense probably damaging 1.00
R8105:Gmppa UTSW 1 75436997 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TAAGCTGTGGCCCCAACTTC -3'
(R):5'- CCTGTTGGGATAGAATGGCTCAG -3'

Sequencing Primer
(F):5'- CAACTTCAGGGAGAGGCTGTTG -3'
(R):5'- ATGGCTCAGGGTGAGTGGAC -3'
Posted On2016-12-15