Mutagenetix > Incidental Mutation

Incidental Mutation 'R5791:Cdh4'

446961

Institutional Source

Beutler Lab

Gene Symbol

Cdh4

Ensembl Gene

ENSMUSG00000000305

Gene Name

cadherin 4

Synonyms

R-Cadh, Rcad, R-cadherin

MMRRC Submission

043207-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5791 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

179442431-179899373 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 179895767 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 864 (V864A)

Ref Sequence

ENSEMBL: ENSMUSP00000000314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000314] [ENSMUST00000098996]

AlphaFold

P39038

Predicted Effect

probably damaging
Transcript: ENSMUST00000000314
AA Change: V864A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000000314
Gene: ENSMUSG00000000305
AA Change: V864A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Cadherin_pro	30	121	1.18e-30	SMART
CA	187	272	2.31e-15	SMART
CA	296	387	4.33e-29	SMART
CA	410	503	2.21e-12	SMART
CA	526	610	7.16e-21	SMART
CA	630	715	3.78e-2	SMART
transmembrane domain	730	752	N/A	INTRINSIC
Pfam:Cadherin_C	760	909	2.5e-52	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098996

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129659

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. The encoded protein is involved in retinal angiogenesis during development where it plays a crucial role in the endothelial-astrocyte interactions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in dilation of the proximal renal tubules and extensive vacuolization of tubule epithelium. Uretic bud epithelium appear disorganized and exhibit increased apoptosis at E15.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam25	G	C	8: 40,754,220	Q174H	probably benign	Het
Adipor2	A	T	6: 119,361,905	M129K	possibly damaging	Het
AI314180	C	T	4: 58,814,027	E1360K	possibly damaging	Het
AI314180	T	A	4: 58,822,111	D1152V	probably damaging	Het
Arhgap29	T	A	3: 122,014,245	M616K	probably damaging	Het
Calcrl	A	T	2: 84,351,265	F180I	probably damaging	Het
Cep78	A	G	19: 15,961,072	F504S	probably benign	Het
Coasy	A	G	11: 101,084,385		probably null	Het
Dnah3	T	C	7: 119,931,473	N751S	probably benign	Het
Eea1	T	A	10: 96,019,995	N631K	probably benign	Het
Fam149b	A	G	14: 20,351,326	K27R	probably damaging	Het
Fbxw26	A	G	9: 109,745,153	W42R	probably damaging	Het
Gas6	A	G	8: 13,470,217		probably null	Het
Gfral	C	T	9: 76,197,046	R228Q	probably benign	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gmppa	T	C	1: 75,442,255	V324A	possibly damaging	Het
Gstm2	C	T	3: 107,984,128		probably null	Het
Kcng3	A	G	17: 83,588,210	S276P	probably benign	Het
Lrrd1	T	C	5: 3,851,254	S520P	probably benign	Het
Lrrn2	A	G	1: 132,937,767	N190S	probably benign	Het
Lrwd1	G	C	5: 136,131,033	A392G	probably benign	Het
Mab21l2	A	G	3: 86,546,737	Y319H	probably damaging	Het
Ndufv3	A	G	17: 31,527,408	N91D	probably benign	Het
Nfatc2	T	A	2: 168,536,393	M451L	probably benign	Het
Olfr980	A	T	9: 40,006,734	S72T	probably damaging	Het
Pcdhgb2	G	T	18: 37,692,340	V795F	possibly damaging	Het
Pdcd11	T	A	19: 47,110,991	M843K	possibly damaging	Het
Pla2g4c	T	A	7: 13,339,692	N221K	probably benign	Het
Ppox	T	C	1: 171,277,312	Y422C	probably damaging	Het
Retreg3	A	G	11: 101,100,943	S55P	probably damaging	Het
Rnf103	C	A	6: 71,508,925	T180K	probably damaging	Het
Tbl3	A	T	17: 24,704,434	L307H	probably damaging	Het
Tex26	A	T	5: 149,439,775		probably null	Het
Tln2	A	T	9: 67,386,605	I247K	probably damaging	Het
Txlnb	T	C	10: 17,799,128	S10P	probably benign	Het
Vwde	C	A	6: 13,195,986	E347*	probably null	Het
Wasf1	G	A	10: 40,926,574	R75Q	probably damaging	Het
Zfp14	A	G	7: 30,038,262	S433P	probably damaging	Het
Zfp647	G	T	15: 76,918,006	A2E	unknown	Het

Other mutations in Cdh4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Cdh4	APN	2	179874144	missense	probably damaging	1.00
IGL01411:Cdh4	APN	2	179780403	missense	probably damaging	0.96
IGL01752:Cdh4	APN	2	179890884	missense	probably damaging	1.00
IGL02814:Cdh4	APN	2	179780474	missense	probably benign	0.01
R0082:Cdh4	UTSW	2	179894188	missense	possibly damaging	0.75
R0357:Cdh4	UTSW	2	179847340	missense	probably damaging	1.00
R1521:Cdh4	UTSW	2	179797558	missense	probably damaging	1.00
R1591:Cdh4	UTSW	2	179886864	critical splice donor site	probably null
R1622:Cdh4	UTSW	2	179889092	missense	possibly damaging	0.56
R1762:Cdh4	UTSW	2	179797480	missense	probably benign	0.01
R1794:Cdh4	UTSW	2	179886842	missense	probably damaging	1.00
R2275:Cdh4	UTSW	2	179890847	missense	probably damaging	1.00
R2277:Cdh4	UTSW	2	179797524	missense	possibly damaging	0.88
R3686:Cdh4	UTSW	2	179780367	missense	probably benign	0.09
R3861:Cdh4	UTSW	2	179874097	missense	probably damaging	1.00
R4078:Cdh4	UTSW	2	179889173	missense	possibly damaging	0.93
R4495:Cdh4	UTSW	2	179780389	missense	probably damaging	0.98
R4715:Cdh4	UTSW	2	179780467	missense	probably benign	0.03
R4893:Cdh4	UTSW	2	179847419	intron	probably benign
R5029:Cdh4	UTSW	2	179881949	missense	possibly damaging	0.93
R5363:Cdh4	UTSW	2	179886763	missense	probably benign
R5542:Cdh4	UTSW	2	179860226	missense	probably damaging	0.98
R5773:Cdh4	UTSW	2	179885996	missense	probably damaging	1.00
R6262:Cdh4	UTSW	2	179797626	missense	probably damaging	1.00
R6338:Cdh4	UTSW	2	179890812	missense	probably damaging	1.00
R6589:Cdh4	UTSW	2	179881996	critical splice donor site	probably null
R6607:Cdh4	UTSW	2	179874096	missense	probably benign	0.00
R6653:Cdh4	UTSW	2	179780428	missense	probably benign	0.34
R6711:Cdh4	UTSW	2	179890931	missense	probably damaging	1.00
R6744:Cdh4	UTSW	2	179847387	missense	possibly damaging	0.68
R6824:Cdh4	UTSW	2	179797558	missense	probably damaging	1.00
R6901:Cdh4	UTSW	2	179860194	missense	probably benign	0.19
R6981:Cdh4	UTSW	2	179797504	missense	probably benign	0.28
R7285:Cdh4	UTSW	2	179797465	missense	probably benign	0.00
R7514:Cdh4	UTSW	2	179890843	missense	possibly damaging	0.91
R7541:Cdh4	UTSW	2	179444810	splice site	probably null
R7560:Cdh4	UTSW	2	179890902	missense	probably benign	0.25
R8146:Cdh4	UTSW	2	179874078	missense	possibly damaging	0.91
R8833:Cdh4	UTSW	2	179894035	missense	possibly damaging	0.61
R9075:Cdh4	UTSW	2	179860147	missense	probably damaging	0.97
R9203:Cdh4	UTSW	2	179780403	missense	probably damaging	0.96
Z1177:Cdh4	UTSW	2	179780326	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- TTGGTCCTTGGAAATATCCCACAG -3'
(R):5'- AGTGCCCTTCTTGCATTGG -3'

Sequencing Primer
(F):5'- GAGTGCCTACTGTATGCAAGATCC -3'
(R):5'- CCCTTCTTGCATTGGTGGTGAG -3'

Posted On

2016-12-15