Incidental Mutation 'R5791:Ecpas'
ID 446965
Institutional Source Beutler Lab
Gene Symbol Ecpas
Ensembl Gene ENSMUSG00000050812
Gene Name Ecm29 proteasome adaptor and scaffold
Synonyms AI314180
MMRRC Submission 043207-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.352) question?
Stock # R5791 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 58798911-58912749 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58822111 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 1152 (D1152V)
Ref Sequence ENSEMBL: ENSMUSP00000117585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000149301]
AlphaFold Q6PDI5
Predicted Effect probably damaging
Transcript: ENSMUST00000102889
AA Change: D1152V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: D1152V

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 1.1e-155 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1491 3e-31 SMART
low complexity region 1781 1797 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135601
Predicted Effect probably damaging
Transcript: ENSMUST00000149301
AA Change: D1152V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812
AA Change: D1152V

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 4e-163 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1490 8e-32 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 41,207,257 (GRCm39) Q174H probably benign Het
Adipor2 A T 6: 119,338,866 (GRCm39) M129K possibly damaging Het
Arhgap29 T A 3: 121,807,894 (GRCm39) M616K probably damaging Het
Calcrl A T 2: 84,181,609 (GRCm39) F180I probably damaging Het
Cdh4 T C 2: 179,537,560 (GRCm39) V864A probably damaging Het
Cep78 A G 19: 15,938,436 (GRCm39) F504S probably benign Het
Coasy A G 11: 100,975,211 (GRCm39) probably null Het
Dnah3 T C 7: 119,530,696 (GRCm39) N751S probably benign Het
Eea1 T A 10: 95,855,857 (GRCm39) N631K probably benign Het
Fam149b A G 14: 20,401,394 (GRCm39) K27R probably damaging Het
Fbxw26 A G 9: 109,574,221 (GRCm39) W42R probably damaging Het
Gas6 A G 8: 13,520,217 (GRCm39) probably null Het
Gfral C T 9: 76,104,328 (GRCm39) R228Q probably benign Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gmppa T C 1: 75,418,899 (GRCm39) V324A possibly damaging Het
Gstm2 C T 3: 107,891,444 (GRCm39) probably null Het
Kcng3 A G 17: 83,895,639 (GRCm39) S276P probably benign Het
Lrrd1 T C 5: 3,901,254 (GRCm39) S520P probably benign Het
Lrrn2 A G 1: 132,865,505 (GRCm39) N190S probably benign Het
Lrwd1 G C 5: 136,159,887 (GRCm39) A392G probably benign Het
Mab21l2 A G 3: 86,454,044 (GRCm39) Y319H probably damaging Het
Ndufv3 A G 17: 31,746,382 (GRCm39) N91D probably benign Het
Nfatc2 T A 2: 168,378,313 (GRCm39) M451L probably benign Het
Or10g9b A T 9: 39,918,030 (GRCm39) S72T probably damaging Het
Pcdhgb2 G T 18: 37,825,393 (GRCm39) V795F possibly damaging Het
Pdcd11 T A 19: 47,099,430 (GRCm39) M843K possibly damaging Het
Pla2g4c T A 7: 13,073,617 (GRCm39) N221K probably benign Het
Ppox T C 1: 171,104,885 (GRCm39) Y422C probably damaging Het
Retreg3 A G 11: 100,991,769 (GRCm39) S55P probably damaging Het
Rnf103 C A 6: 71,485,909 (GRCm39) T180K probably damaging Het
Tbl3 A T 17: 24,923,408 (GRCm39) L307H probably damaging Het
Tex26 A T 5: 149,363,240 (GRCm39) probably null Het
Tln2 A T 9: 67,293,887 (GRCm39) I247K probably damaging Het
Txlnb T C 10: 17,674,876 (GRCm39) S10P probably benign Het
Vwde C A 6: 13,195,985 (GRCm39) E347* probably null Het
Wasf1 G A 10: 40,802,570 (GRCm39) R75Q probably damaging Het
Zfp14 A G 7: 29,737,687 (GRCm39) S433P probably damaging Het
Zfp647 G T 15: 76,802,206 (GRCm39) A2E unknown Het
Other mutations in Ecpas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Ecpas APN 4 58,828,047 (GRCm39) missense possibly damaging 0.95
IGL01145:Ecpas APN 4 58,811,501 (GRCm39) missense probably null 0.08
IGL01371:Ecpas APN 4 58,809,718 (GRCm39) missense probably damaging 1.00
IGL01445:Ecpas APN 4 58,833,988 (GRCm39) missense probably benign 0.08
IGL01452:Ecpas APN 4 58,836,181 (GRCm39) missense probably damaging 0.99
IGL01626:Ecpas APN 4 58,832,814 (GRCm39) splice site probably benign
IGL01672:Ecpas APN 4 58,814,041 (GRCm39) missense probably benign 0.40
IGL01943:Ecpas APN 4 58,849,937 (GRCm39) missense possibly damaging 0.91
IGL01944:Ecpas APN 4 58,861,544 (GRCm39) missense probably benign 0.42
IGL02190:Ecpas APN 4 58,800,190 (GRCm39) missense probably benign 0.12
IGL02272:Ecpas APN 4 58,811,731 (GRCm39) missense probably benign 0.00
IGL02435:Ecpas APN 4 58,830,325 (GRCm39) splice site probably benign
IGL02516:Ecpas APN 4 58,877,102 (GRCm39) missense probably damaging 1.00
IGL02540:Ecpas APN 4 58,805,534 (GRCm39) splice site probably benign
IGL02709:Ecpas APN 4 58,872,699 (GRCm39) missense possibly damaging 0.90
IGL02742:Ecpas APN 4 58,840,757 (GRCm39) missense probably damaging 0.96
IGL02812:Ecpas APN 4 58,864,343 (GRCm39) splice site probably benign
IGL02828:Ecpas APN 4 58,875,512 (GRCm39) missense possibly damaging 0.59
IGL03130:Ecpas APN 4 58,800,288 (GRCm39) missense probably benign
IGL03179:Ecpas APN 4 58,832,777 (GRCm39) missense probably damaging 1.00
IGL03237:Ecpas APN 4 58,810,668 (GRCm39) missense probably benign 0.40
IGL03344:Ecpas APN 4 58,828,538 (GRCm39) missense probably damaging 1.00
boone UTSW 4 58,877,157 (GRCm39) missense probably damaging 1.00
Crockett UTSW 4 58,879,100 (GRCm39) missense probably damaging 1.00
frontiersman UTSW 4 58,832,753 (GRCm39) missense probably benign
BB006:Ecpas UTSW 4 58,869,554 (GRCm39) missense probably damaging 1.00
BB016:Ecpas UTSW 4 58,869,554 (GRCm39) missense probably damaging 1.00
R0051:Ecpas UTSW 4 58,832,729 (GRCm39) missense probably damaging 1.00
R0051:Ecpas UTSW 4 58,832,729 (GRCm39) missense probably damaging 1.00
R0313:Ecpas UTSW 4 58,811,892 (GRCm39) missense probably benign 0.11
R0399:Ecpas UTSW 4 58,827,047 (GRCm39) missense possibly damaging 0.69
R0487:Ecpas UTSW 4 58,819,155 (GRCm39) missense probably damaging 1.00
R0492:Ecpas UTSW 4 58,864,418 (GRCm39) missense probably damaging 1.00
R0705:Ecpas UTSW 4 58,885,366 (GRCm39) critical splice donor site probably null
R0847:Ecpas UTSW 4 58,841,439 (GRCm39) missense probably benign 0.14
R1467:Ecpas UTSW 4 58,832,753 (GRCm39) missense probably benign
R1467:Ecpas UTSW 4 58,832,753 (GRCm39) missense probably benign
R1482:Ecpas UTSW 4 58,820,163 (GRCm39) missense possibly damaging 0.85
R1529:Ecpas UTSW 4 58,832,701 (GRCm39) splice site probably null
R1771:Ecpas UTSW 4 58,879,100 (GRCm39) missense probably damaging 1.00
R1776:Ecpas UTSW 4 58,879,100 (GRCm39) missense probably damaging 1.00
R1822:Ecpas UTSW 4 58,805,539 (GRCm39) critical splice donor site probably null
R1864:Ecpas UTSW 4 58,849,942 (GRCm39) missense possibly damaging 0.62
R2029:Ecpas UTSW 4 58,844,165 (GRCm39) nonsense probably null
R2061:Ecpas UTSW 4 58,824,270 (GRCm39) missense probably damaging 1.00
R2125:Ecpas UTSW 4 58,833,978 (GRCm39) missense probably benign
R2266:Ecpas UTSW 4 58,830,332 (GRCm39) critical splice donor site probably null
R2889:Ecpas UTSW 4 58,836,165 (GRCm39) missense probably benign
R2902:Ecpas UTSW 4 58,809,691 (GRCm39) missense probably benign 0.31
R2903:Ecpas UTSW 4 58,828,622 (GRCm39) missense possibly damaging 0.50
R2925:Ecpas UTSW 4 58,833,928 (GRCm39) nonsense probably null
R4151:Ecpas UTSW 4 58,836,254 (GRCm39) missense possibly damaging 0.51
R4225:Ecpas UTSW 4 58,847,027 (GRCm39) missense probably damaging 1.00
R4486:Ecpas UTSW 4 58,820,086 (GRCm39) intron probably benign
R4576:Ecpas UTSW 4 58,834,708 (GRCm39) intron probably benign
R4580:Ecpas UTSW 4 58,840,751 (GRCm39) missense probably damaging 1.00
R4654:Ecpas UTSW 4 58,834,523 (GRCm39) missense possibly damaging 0.86
R4688:Ecpas UTSW 4 58,840,757 (GRCm39) missense probably damaging 0.96
R4726:Ecpas UTSW 4 58,844,191 (GRCm39) missense probably damaging 1.00
R4825:Ecpas UTSW 4 58,850,911 (GRCm39) missense probably damaging 0.99
R4928:Ecpas UTSW 4 58,827,073 (GRCm39) missense probably damaging 1.00
R5098:Ecpas UTSW 4 58,877,048 (GRCm39) missense probably damaging 1.00
R5284:Ecpas UTSW 4 58,836,172 (GRCm39) missense possibly damaging 0.90
R5375:Ecpas UTSW 4 58,809,401 (GRCm39) nonsense probably null
R5382:Ecpas UTSW 4 58,850,934 (GRCm39) missense probably benign 0.38
R5487:Ecpas UTSW 4 58,809,421 (GRCm39) missense probably benign 0.22
R5703:Ecpas UTSW 4 58,877,171 (GRCm39) splice site probably null
R5761:Ecpas UTSW 4 58,853,131 (GRCm39) missense probably damaging 1.00
R5791:Ecpas UTSW 4 58,814,027 (GRCm39) missense possibly damaging 0.90
R5928:Ecpas UTSW 4 58,849,948 (GRCm39) missense possibly damaging 0.59
R6062:Ecpas UTSW 4 58,826,453 (GRCm39) missense possibly damaging 0.84
R6246:Ecpas UTSW 4 58,811,365 (GRCm39) splice site probably null
R6298:Ecpas UTSW 4 58,877,157 (GRCm39) missense probably damaging 1.00
R6326:Ecpas UTSW 4 58,827,068 (GRCm39) missense probably benign 0.34
R6478:Ecpas UTSW 4 58,810,785 (GRCm39) missense probably damaging 1.00
R6707:Ecpas UTSW 4 58,879,101 (GRCm39) missense possibly damaging 0.52
R6846:Ecpas UTSW 4 58,814,081 (GRCm39) missense possibly damaging 0.85
R6857:Ecpas UTSW 4 58,814,065 (GRCm39) missense probably damaging 1.00
R6951:Ecpas UTSW 4 58,853,114 (GRCm39) critical splice donor site probably null
R7088:Ecpas UTSW 4 58,849,766 (GRCm39) missense possibly damaging 0.93
R7302:Ecpas UTSW 4 58,834,593 (GRCm39) missense probably benign 0.43
R7337:Ecpas UTSW 4 58,827,047 (GRCm39) missense possibly damaging 0.69
R7341:Ecpas UTSW 4 58,809,415 (GRCm39) missense possibly damaging 0.94
R7344:Ecpas UTSW 4 58,824,770 (GRCm39) missense probably benign 0.08
R7525:Ecpas UTSW 4 58,847,038 (GRCm39) missense possibly damaging 0.84
R7530:Ecpas UTSW 4 58,815,317 (GRCm39) missense probably damaging 0.99
R7533:Ecpas UTSW 4 58,809,411 (GRCm39) missense probably benign 0.12
R7557:Ecpas UTSW 4 58,849,691 (GRCm39) missense possibly damaging 0.85
R7698:Ecpas UTSW 4 58,832,660 (GRCm39) missense unknown
R7793:Ecpas UTSW 4 58,853,150 (GRCm39) missense probably damaging 1.00
R7892:Ecpas UTSW 4 58,828,593 (GRCm39) missense probably benign
R7894:Ecpas UTSW 4 58,853,708 (GRCm39) missense probably damaging 1.00
R7929:Ecpas UTSW 4 58,869,554 (GRCm39) missense probably damaging 1.00
R8010:Ecpas UTSW 4 58,832,681 (GRCm39) missense unknown
R8082:Ecpas UTSW 4 58,807,852 (GRCm39) missense probably benign 0.00
R8175:Ecpas UTSW 4 58,872,756 (GRCm39) missense probably damaging 1.00
R8191:Ecpas UTSW 4 58,872,587 (GRCm39) critical splice donor site probably null
R8326:Ecpas UTSW 4 58,847,093 (GRCm39) missense probably damaging 1.00
R8459:Ecpas UTSW 4 58,821,379 (GRCm39) missense probably damaging 1.00
R8683:Ecpas UTSW 4 58,834,515 (GRCm39) missense probably benign 0.31
R8747:Ecpas UTSW 4 58,828,632 (GRCm39) missense probably damaging 0.98
R8981:Ecpas UTSW 4 58,801,796 (GRCm39) missense probably benign
R9206:Ecpas UTSW 4 58,875,444 (GRCm39) missense probably damaging 1.00
R9208:Ecpas UTSW 4 58,875,444 (GRCm39) missense probably damaging 1.00
R9231:Ecpas UTSW 4 58,875,533 (GRCm39) missense probably damaging 1.00
R9249:Ecpas UTSW 4 58,869,427 (GRCm39) missense probably damaging 1.00
R9355:Ecpas UTSW 4 58,844,114 (GRCm39) missense probably benign 0.23
R9534:Ecpas UTSW 4 58,807,867 (GRCm39) missense probably benign
R9555:Ecpas UTSW 4 58,879,083 (GRCm39) missense possibly damaging 0.92
R9570:Ecpas UTSW 4 58,832,796 (GRCm39) nonsense probably null
R9673:Ecpas UTSW 4 58,822,060 (GRCm39) missense probably benign
R9707:Ecpas UTSW 4 58,824,816 (GRCm39) critical splice acceptor site probably null
R9721:Ecpas UTSW 4 58,850,938 (GRCm39) missense probably benign 0.39
X0060:Ecpas UTSW 4 58,840,752 (GRCm39) missense possibly damaging 0.73
Z1177:Ecpas UTSW 4 58,861,614 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCACTGAGTACATAACAAGCACTG -3'
(R):5'- ATGAGTCACAGTGGGCTTTG -3'

Sequencing Primer
(F):5'- AGCCATGAATTATACAACTTGATGTC -3'
(R):5'- TGTGTTGTATAAAGCCCACCTG -3'
Posted On 2016-12-15