Incidental Mutation 'R5791:Lrrd1'
ID446966
Institutional Source Beutler Lab
Gene Symbol Lrrd1
Ensembl Gene ENSMUSG00000040367
Gene Nameleucine rich repeats and death domain containing 1
Synonyms4932412H11Rik
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location3845173-3866596 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3851254 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 520 (S520P)
Ref Sequence ENSEMBL: ENSMUSP00000038675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044039] [ENSMUST00000143027]
Predicted Effect probably benign
Transcript: ENSMUST00000044039
AA Change: S520P

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038675
Gene: ENSMUSG00000040367
AA Change: S520P

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
LRR 181 203 3.18e1 SMART
LRR 204 226 7.8e1 SMART
LRR 227 249 5.26e0 SMART
LRR 250 272 3.98e1 SMART
LRR 273 294 2.33e1 SMART
LRR 296 318 2.14e1 SMART
LRR_TYP 319 342 1.45e-2 SMART
LRR 365 388 4.44e0 SMART
LRR 389 410 2.76e1 SMART
LRR 411 433 8.73e1 SMART
LRR 434 457 3.55e1 SMART
LRR 480 503 1.45e1 SMART
LRR 526 548 1.31e0 SMART
LRR 549 571 3.65e1 SMART
LRR 572 594 6.22e0 SMART
LRR 595 618 2.68e1 SMART
LRR 644 665 1.15e1 SMART
LRR 667 689 8.01e0 SMART
LRR 690 713 1.53e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143027
SMART Domains Protein: ENSMUSP00000122668
Gene: ENSMUSG00000040367

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Gstm2 C T 3: 107,984,128 probably null Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Lrrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Lrrd1 APN 5 3850573 missense possibly damaging 0.94
IGL00329:Lrrd1 APN 5 3850081 missense possibly damaging 0.94
IGL00674:Lrrd1 APN 5 3849773 missense possibly damaging 0.92
IGL00691:Lrrd1 APN 5 3863929 missense probably damaging 0.98
IGL00839:Lrrd1 APN 5 3850017 missense probably benign 0.00
IGL00911:Lrrd1 APN 5 3865689 missense probably benign 0.07
IGL01754:Lrrd1 APN 5 3851432 missense probably damaging 1.00
IGL01981:Lrrd1 APN 5 3851267 missense probably damaging 1.00
IGL02003:Lrrd1 APN 5 3849857 missense probably damaging 0.99
IGL02223:Lrrd1 APN 5 3850211 missense probably benign
IGL02477:Lrrd1 APN 5 3865770 missense probably benign
IGL02609:Lrrd1 APN 5 3858803 missense probably benign 0.26
IGL02833:Lrrd1 APN 5 3850709 missense probably damaging 0.98
IGL02886:Lrrd1 APN 5 3851534 missense probably benign 0.00
IGL02896:Lrrd1 APN 5 3851473 missense probably benign 0.08
R0045:Lrrd1 UTSW 5 3866418 missense possibly damaging 0.50
R0138:Lrrd1 UTSW 5 3851345 missense probably benign 0.04
R0305:Lrrd1 UTSW 5 3865707 missense probably damaging 1.00
R0346:Lrrd1 UTSW 5 3850215 missense probably benign 0.03
R0455:Lrrd1 UTSW 5 3866425 missense probably benign 0.21
R1717:Lrrd1 UTSW 5 3850580 missense probably damaging 0.99
R1719:Lrrd1 UTSW 5 3850483 splice site probably null
R1836:Lrrd1 UTSW 5 3865709 missense probably benign 0.36
R1951:Lrrd1 UTSW 5 3851488 missense probably damaging 1.00
R2199:Lrrd1 UTSW 5 3866478 missense possibly damaging 0.86
R3751:Lrrd1 UTSW 5 3850282 missense probably benign 0.37
R3752:Lrrd1 UTSW 5 3850282 missense probably benign 0.37
R3837:Lrrd1 UTSW 5 3850204 missense possibly damaging 0.73
R3862:Lrrd1 UTSW 5 3851248 missense probably benign 0.00
R3863:Lrrd1 UTSW 5 3851248 missense probably benign 0.00
R3864:Lrrd1 UTSW 5 3851248 missense probably benign 0.00
R4816:Lrrd1 UTSW 5 3851126 nonsense probably null
R5225:Lrrd1 UTSW 5 3858735 missense probably benign 0.00
R5721:Lrrd1 UTSW 5 3850619 missense probably benign 0.13
R6077:Lrrd1 UTSW 5 3850837 missense probably benign 0.01
R6229:Lrrd1 UTSW 5 3863887 missense probably damaging 1.00
R6330:Lrrd1 UTSW 5 3850629 missense probably damaging 1.00
R6588:Lrrd1 UTSW 5 3851386 missense probably benign 0.19
R6734:Lrrd1 UTSW 5 3850226 missense possibly damaging 0.95
R6932:Lrrd1 UTSW 5 3851395 missense probably benign 0.06
R7180:Lrrd1 UTSW 5 3851459 missense probably damaging 1.00
R7771:Lrrd1 UTSW 5 3866476 missense possibly damaging 0.84
Z1176:Lrrd1 UTSW 5 3850025 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCAGGCAATCAAATCACACATGTTC -3'
(R):5'- TTCTGAAATATCAAGCACTCGCAAG -3'

Sequencing Primer
(F):5'- CAATCAAATCACACATGTTCCTATTG -3'
(R):5'- TTCGGGAAACTCTCGAAC -3'
Posted On2016-12-15