Incidental Mutation 'R5791:Vwde'
ID446969
Institutional Source Beutler Lab
Gene Symbol Vwde
Ensembl Gene ENSMUSG00000079679
Gene Namevon Willebrand factor D and EGF domains
SynonymsLOC232585
MMRRC Submission 043207-MU
Accession Numbers

Genbank: NM_001013757; MGI: 2685313 

Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location13156299-13224965 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 13195986 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 347 (E347*)
Ref Sequence ENSEMBL: ENSMUSP00000145311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054530] [ENSMUST00000203074]
Predicted Effect probably null
Transcript: ENSMUST00000054530
AA Change: E347*
SMART Domains Protein: ENSMUSP00000058110
Gene: ENSMUSG00000079679
AA Change: E347*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:ZP 58 163 1e-5 BLAST
low complexity region 192 199 N/A INTRINSIC
VWD 420 588 1.51e-4 SMART
low complexity region 638 651 N/A INTRINSIC
Blast:EGF_like 890 918 2e-9 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000203074
AA Change: E347*
SMART Domains Protein: ENSMUSP00000145311
Gene: ENSMUSG00000079679
AA Change: E347*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 192 199 N/A INTRINSIC
VWD 420 588 7.4e-7 SMART
low complexity region 638 651 N/A INTRINSIC
EGF_like 890 918 1.5e-1 SMART
EGF 1166 1217 8.5e-6 SMART
EGF_like 1182 1233 2.7e-2 SMART
EGF 1222 1254 9.7e-7 SMART
EGF_CA 1256 1295 5.3e-12 SMART
EGF 1446 1483 5e-2 SMART
EGF 1485 1514 3.8e-3 SMART
EGF 1517 1546 3.6e-3 SMART
EGF 1549 1578 8e-7 SMART
EGF 1581 1610 3.4e-3 SMART
EGF 1613 1642 1.5e-3 SMART
EGF 1645 1674 1.1e-5 SMART
EGF 1677 1706 2.5e-4 SMART
EGF 1709 1738 2.5e-3 SMART
EGF 1741 1770 1.8e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204339
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Gstm2 C T 3: 107,984,128 probably null Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Vwde
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Vwde APN 6 13187412 missense probably benign 0.00
IGL01391:Vwde APN 6 13190527 missense probably benign 0.07
IGL01432:Vwde APN 6 13193240 missense probably benign 0.18
IGL01611:Vwde APN 6 13219978 missense probably damaging 1.00
IGL01835:Vwde APN 6 13186824 missense probably benign 0.43
IGL01993:Vwde APN 6 13219978 missense possibly damaging 0.89
IGL01997:Vwde APN 6 13215706 missense probably damaging 1.00
IGL02390:Vwde APN 6 13190685 missense probably damaging 1.00
IGL02612:Vwde APN 6 13187149 missense probably damaging 1.00
IGL02723:Vwde APN 6 13205760 missense probably damaging 0.99
IGL02731:Vwde APN 6 13192614 missense probably damaging 1.00
IGL02869:Vwde APN 6 13187137 missense probably damaging 1.00
IGL02981:Vwde APN 6 13193113 missense possibly damaging 0.84
IGL03031:Vwde APN 6 13208382 missense probably benign 0.10
IGL03180:Vwde APN 6 13205765 missense probably damaging 1.00
IGL03182:Vwde APN 6 13187139 missense probably damaging 1.00
willy_brandt UTSW 6 13208405 splice site probably null
C9142:Vwde UTSW 6 13168054 splice site probably benign
R0089:Vwde UTSW 6 13220005 missense probably damaging 1.00
R0244:Vwde UTSW 6 13193126 missense probably benign 0.16
R0355:Vwde UTSW 6 13187807 splice site probably benign
R0455:Vwde UTSW 6 13187529 missense probably benign 0.03
R0465:Vwde UTSW 6 13215806 splice site probably benign
R0946:Vwde UTSW 6 13187875 missense probably damaging 1.00
R1087:Vwde UTSW 6 13186804 missense probably damaging 1.00
R1236:Vwde UTSW 6 13187153 nonsense probably null
R1738:Vwde UTSW 6 13190724 missense probably damaging 1.00
R1891:Vwde UTSW 6 13187455 missense probably damaging 0.98
R2014:Vwde UTSW 6 13208338 missense possibly damaging 0.91
R2015:Vwde UTSW 6 13208338 missense possibly damaging 0.91
R2303:Vwde UTSW 6 13215807 splice site probably benign
R3439:Vwde UTSW 6 13208375 missense probably damaging 0.98
R3688:Vwde UTSW 6 13186892 missense probably damaging 0.96
R4457:Vwde UTSW 6 13196101 missense probably damaging 1.00
R4755:Vwde UTSW 6 13205852 missense possibly damaging 0.94
R4849:Vwde UTSW 6 13196048 missense possibly damaging 0.92
R4850:Vwde UTSW 6 13196048 missense possibly damaging 0.92
R4851:Vwde UTSW 6 13196048 missense possibly damaging 0.92
R4853:Vwde UTSW 6 13215640 missense probably damaging 1.00
R4951:Vwde UTSW 6 13187139 missense probably damaging 1.00
R5023:Vwde UTSW 6 13192642 missense possibly damaging 0.48
R5057:Vwde UTSW 6 13192642 missense possibly damaging 0.48
R5060:Vwde UTSW 6 13208324 splice site probably null
R5126:Vwde UTSW 6 13187260 missense probably benign 0.04
R5154:Vwde UTSW 6 13215758 missense probably benign 0.01
R5277:Vwde UTSW 6 13186996 missense probably benign 0.03
R5432:Vwde UTSW 6 13190592 missense probably damaging 1.00
R5436:Vwde UTSW 6 13190628 missense probably damaging 1.00
R5472:Vwde UTSW 6 13193118 missense probably benign 0.00
R5518:Vwde UTSW 6 13186938 missense probably benign 0.00
R6045:Vwde UTSW 6 13219936 missense probably damaging 1.00
R6262:Vwde UTSW 6 13205021 missense probably damaging 1.00
R6482:Vwde UTSW 6 13205844 missense probably damaging 1.00
R6500:Vwde UTSW 6 13208405 splice site probably null
R6562:Vwde UTSW 6 13193123 missense possibly damaging 0.84
R6905:Vwde UTSW 6 13205927 missense probably damaging 1.00
R7021:Vwde UTSW 6 13186906 missense probably damaging 1.00
R7103:Vwde UTSW 6 13215800 missense probably benign 0.03
R7356:Vwde UTSW 6 13192642 missense probably damaging 0.96
R7434:Vwde UTSW 6 13187640 missense probably benign 0.00
R7492:Vwde UTSW 6 13204981 missense probably null 1.00
R8026:Vwde UTSW 6 13205783 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCCGCGCAACCTTGTATCAG -3'
(R):5'- CTAAGCAAAAGATAGCCTACTGGGG -3'

Sequencing Primer
(F):5'- GGACTCTCTGGAAAACAGA -3'
(R):5'- TAGCCTACTGGGGTAACAAAAAC -3'
Posted On2016-12-15