Mutagenetix > Incidental Mutations

Incidental Mutation 'R5791:Rnf103'

446970

Institutional Source

Beutler Lab

Gene Symbol

Rnf103

Ensembl Gene

ENSMUSG00000052656

Gene Name

ring finger protein 103

Synonyms

Zfp103, kf-1

MMRRC Submission

043207-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.165) question?

Stock #

R5791 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

71493894-71510881 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 71508925 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 180 (T180K)

Ref Sequence

ENSEMBL: ENSMUSP00000109817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064637] [ENSMUST00000114178] [ENSMUST00000114179]

Predicted Effect

probably damaging
Transcript: ENSMUST00000064637
AA Change: T180K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000066324
Gene: ENSMUSG00000052656
AA Change: T180K

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	326	348	N/A	INTRINSIC
transmembrane domain	353	375	N/A	INTRINSIC
transmembrane domain	412	431	N/A	INTRINSIC
low complexity region	523	531	N/A	INTRINSIC
RING	619	660	5.07e-6	SMART
low complexity region	665	676	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114178

SMART Domains

Protein: ENSMUSP00000109816
Gene: ENSMUSG00000052656

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
low complexity region	162	173	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114179
AA Change: T180K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109817
Gene: ENSMUSG00000052656
AA Change: T180K

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	326	348	N/A	INTRINSIC
transmembrane domain	353	375	N/A	INTRINSIC
transmembrane domain	412	431	N/A	INTRINSIC
low complexity region	523	531	N/A	INTRINSIC
RING	619	660	5.07e-6	SMART
low complexity region	665	676	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150069

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the RING finger family of E3 ubiquitin-protein ligases. These proteins catalyze the transfer of the ubiquitin protein from a ubiquitin E2 enzyme to a protein substrate. Homozygous knockout mice for this gene exhibit enhanced anxiety-like behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display significantly increased anxiety-like behavior under stressful conditions as well as increased prepulse inhibition and a reduced startle amplitude with no detectable changes in exploratory locomotion or behavioral despair. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam25	G	C	8: 40,754,220	Q174H	probably benign	Het
Adipor2	A	T	6: 119,361,905	M129K	possibly damaging	Het
AI314180	C	T	4: 58,814,027	E1360K	possibly damaging	Het
AI314180	T	A	4: 58,822,111	D1152V	probably damaging	Het
Arhgap29	T	A	3: 122,014,245	M616K	probably damaging	Het
Calcrl	A	T	2: 84,351,265	F180I	probably damaging	Het
Cdh4	T	C	2: 179,895,767	V864A	probably damaging	Het
Cep78	A	G	19: 15,961,072	F504S	probably benign	Het
Coasy	A	G	11: 101,084,385		probably null	Het
Dnah3	T	C	7: 119,931,473	N751S	probably benign	Het
Eea1	T	A	10: 96,019,995	N631K	probably benign	Het
Fam149b	A	G	14: 20,351,326	K27R	probably damaging	Het
Fbxw26	A	G	9: 109,745,153	W42R	probably damaging	Het
Gas6	A	G	8: 13,470,217		probably null	Het
Gfral	C	T	9: 76,197,046	R228Q	probably benign	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gmppa	T	C	1: 75,442,255	V324A	possibly damaging	Het
Gstm2	C	T	3: 107,984,128		probably null	Het
Kcng3	A	G	17: 83,588,210	S276P	probably benign	Het
Lrrd1	T	C	5: 3,851,254	S520P	probably benign	Het
Lrrn2	A	G	1: 132,937,767	N190S	probably benign	Het
Lrwd1	G	C	5: 136,131,033	A392G	probably benign	Het
Mab21l2	A	G	3: 86,546,737	Y319H	probably damaging	Het
Ndufv3	A	G	17: 31,527,408	N91D	probably benign	Het
Nfatc2	T	A	2: 168,536,393	M451L	probably benign	Het
Olfr980	A	T	9: 40,006,734	S72T	probably damaging	Het
Pcdhgb2	G	T	18: 37,692,340	V795F	possibly damaging	Het
Pdcd11	T	A	19: 47,110,991	M843K	possibly damaging	Het
Pla2g4c	T	A	7: 13,339,692	N221K	probably benign	Het
Ppox	T	C	1: 171,277,312	Y422C	probably damaging	Het
Retreg3	A	G	11: 101,100,943	S55P	probably damaging	Het
Tbl3	A	T	17: 24,704,434	L307H	probably damaging	Het
Tex26	A	T	5: 149,439,775		probably null	Het
Tln2	A	T	9: 67,386,605	I247K	probably damaging	Het
Txlnb	T	C	10: 17,799,128	S10P	probably benign	Het
Vwde	C	A	6: 13,195,986	E347*	probably null	Het
Wasf1	G	A	10: 40,926,574	R75Q	probably damaging	Het
Zfp14	A	G	7: 30,038,262	S433P	probably damaging	Het
Zfp647	G	T	15: 76,918,006	A2E	unknown	Het

Other mutations in Rnf103

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00510:Rnf103	APN	6	71509749	missense	probably damaging	0.99
IGL00589:Rnf103	APN	6	71509083	missense	probably benign	0.00
IGL01601:Rnf103	APN	6	71509183	missense	probably damaging	1.00
IGL01732:Rnf103	APN	6	71510382	missense	probably damaging	0.97
IGL02130:Rnf103	APN	6	71509564	missense	probably damaging	1.00
IGL02227:Rnf103	APN	6	71510188	missense	probably benign	0.01
IGL02386:Rnf103	APN	6	71509218	missense	probably benign
IGL02532:Rnf103	APN	6	71509825	missense	probably benign	0.19
IGL02532:Rnf103	APN	6	71509652	missense	probably damaging	0.96
IGL02747:Rnf103	APN	6	71509177	missense	probably damaging	0.97
IGL02839:Rnf103	APN	6	71509705	missense	probably benign	0.41
IGL03247:Rnf103	APN	6	71510305	missense	possibly damaging	0.78
R0140:Rnf103	UTSW	6	71509331	missense	possibly damaging	0.76
R0308:Rnf103	UTSW	6	71509702	missense	probably damaging	1.00
R0764:Rnf103	UTSW	6	71509582	missense	probably damaging	0.96
R1428:Rnf103	UTSW	6	71508999	missense	probably damaging	1.00
R2362:Rnf103	UTSW	6	71510017	missense	probably benign	0.08
R3847:Rnf103	UTSW	6	71508875	missense	probably damaging	1.00
R3849:Rnf103	UTSW	6	71508875	missense	probably damaging	1.00
R3919:Rnf103	UTSW	6	71510347	missense	probably benign	0.08
R4914:Rnf103	UTSW	6	71510264	missense	possibly damaging	0.71
R5620:Rnf103	UTSW	6	71510008	missense	probably benign	0.04
R5634:Rnf103	UTSW	6	71509617	missense	probably benign	0.01
R5682:Rnf103	UTSW	6	71508724	intron	probably benign
R5994:Rnf103	UTSW	6	71496910	missense	probably damaging	0.99
R6347:Rnf103	UTSW	6	71505824	missense	possibly damaging	0.89
R6551:Rnf103	UTSW	6	71510365	missense	probably damaging	1.00
R7739:Rnf103	UTSW	6	71509479	missense	possibly damaging	0.77
R7819:Rnf103	UTSW	6	71508930	missense	probably benign	0.00
R7903:Rnf103	UTSW	6	71509154	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAACTTGCTTGTTCTGGCAC -3'
(R):5'- CGGTTGGTCAAGGTTTGCAAATAG -3'

Sequencing Primer
(F):5'- CAAGTATTGGTCTCTCTTTGGTTAC -3'
(R):5'- TGATCCGAGAAGCTGCAT -3'

Posted On

2016-12-15