Incidental Mutation 'R5791:Rnf103'
ID446970
Institutional Source Beutler Lab
Gene Symbol Rnf103
Ensembl Gene ENSMUSG00000052656
Gene Namering finger protein 103
SynonymsZfp103, kf-1
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location71493894-71510881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 71508925 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 180 (T180K)
Ref Sequence ENSEMBL: ENSMUSP00000109817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064637] [ENSMUST00000114178] [ENSMUST00000114179]
Predicted Effect probably damaging
Transcript: ENSMUST00000064637
AA Change: T180K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066324
Gene: ENSMUSG00000052656
AA Change: T180K

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 412 431 N/A INTRINSIC
low complexity region 523 531 N/A INTRINSIC
RING 619 660 5.07e-6 SMART
low complexity region 665 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114178
SMART Domains Protein: ENSMUSP00000109816
Gene: ENSMUSG00000052656

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114179
AA Change: T180K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109817
Gene: ENSMUSG00000052656
AA Change: T180K

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 412 431 N/A INTRINSIC
low complexity region 523 531 N/A INTRINSIC
RING 619 660 5.07e-6 SMART
low complexity region 665 676 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150069
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the RING finger family of E3 ubiquitin-protein ligases. These proteins catalyze the transfer of the ubiquitin protein from a ubiquitin E2 enzyme to a protein substrate. Homozygous knockout mice for this gene exhibit enhanced anxiety-like behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display significantly increased anxiety-like behavior under stressful conditions as well as increased prepulse inhibition and a reduced startle amplitude with no detectable changes in exploratory locomotion or behavioral despair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Gstm2 C T 3: 107,984,128 probably null Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Rnf103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Rnf103 APN 6 71509749 missense probably damaging 0.99
IGL00589:Rnf103 APN 6 71509083 missense probably benign 0.00
IGL01601:Rnf103 APN 6 71509183 missense probably damaging 1.00
IGL01732:Rnf103 APN 6 71510382 missense probably damaging 0.97
IGL02130:Rnf103 APN 6 71509564 missense probably damaging 1.00
IGL02227:Rnf103 APN 6 71510188 missense probably benign 0.01
IGL02386:Rnf103 APN 6 71509218 missense probably benign
IGL02532:Rnf103 APN 6 71509825 missense probably benign 0.19
IGL02532:Rnf103 APN 6 71509652 missense probably damaging 0.96
IGL02747:Rnf103 APN 6 71509177 missense probably damaging 0.97
IGL02839:Rnf103 APN 6 71509705 missense probably benign 0.41
IGL03247:Rnf103 APN 6 71510305 missense possibly damaging 0.78
R0140:Rnf103 UTSW 6 71509331 missense possibly damaging 0.76
R0308:Rnf103 UTSW 6 71509702 missense probably damaging 1.00
R0764:Rnf103 UTSW 6 71509582 missense probably damaging 0.96
R1428:Rnf103 UTSW 6 71508999 missense probably damaging 1.00
R2362:Rnf103 UTSW 6 71510017 missense probably benign 0.08
R3847:Rnf103 UTSW 6 71508875 missense probably damaging 1.00
R3849:Rnf103 UTSW 6 71508875 missense probably damaging 1.00
R3919:Rnf103 UTSW 6 71510347 missense probably benign 0.08
R4914:Rnf103 UTSW 6 71510264 missense possibly damaging 0.71
R5620:Rnf103 UTSW 6 71510008 missense probably benign 0.04
R5634:Rnf103 UTSW 6 71509617 missense probably benign 0.01
R5682:Rnf103 UTSW 6 71508724 intron probably benign
R5994:Rnf103 UTSW 6 71496910 missense probably damaging 0.99
R6347:Rnf103 UTSW 6 71505824 missense possibly damaging 0.89
R6551:Rnf103 UTSW 6 71510365 missense probably damaging 1.00
R7739:Rnf103 UTSW 6 71509479 missense possibly damaging 0.77
R7819:Rnf103 UTSW 6 71508930 missense probably benign 0.00
R7903:Rnf103 UTSW 6 71509154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTTGCTTGTTCTGGCAC -3'
(R):5'- CGGTTGGTCAAGGTTTGCAAATAG -3'

Sequencing Primer
(F):5'- CAAGTATTGGTCTCTCTTTGGTTAC -3'
(R):5'- TGATCCGAGAAGCTGCAT -3'
Posted On2016-12-15