Incidental Mutation 'R5791:Adipor2'
ID 446971
Institutional Source Beutler Lab
Gene Symbol Adipor2
Ensembl Gene ENSMUSG00000030168
Gene Name adiponectin receptor 2
Synonyms 1110001I14Rik, D6Ucla1e
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock # R5791 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 119353150-119417704 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119361905 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 129 (M129K)
Ref Sequence ENSEMBL: ENSMUSP00000126138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032272] [ENSMUST00000169744] [ENSMUST00000187699]
AlphaFold Q8BQS5
Predicted Effect possibly damaging
Transcript: ENSMUST00000032272
AA Change: M129K

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032272
Gene: ENSMUSG00000030168
AA Change: M129K

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
Blast:RING 81 138 3e-26 BLAST
Pfam:HlyIII 140 363 6.9e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169744
AA Change: M129K

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126138
Gene: ENSMUSG00000030168
AA Change: M129K

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
Blast:RING 81 138 3e-26 BLAST
Pfam:HlyIII 140 363 6.9e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187699
SMART Domains Protein: ENSMUSP00000139703
Gene: ENSMUSG00000030168

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188851
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The adiponectin receptors, ADIPOR1 (MIM 607945) and ADIPOR2, serve as receptors for globular and full-length adiponectin (MIM 605441) and mediate increased AMPK (see MIM 602739) and PPAR-alpha (PPARA; MIM 170998) ligand activities, as well as fatty acid oxidation and glucose uptake by adiponectin (Yamauchi et al., 2003 [PubMed 12802337]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display small testes and epididymis, degeneration of the seminiferous tubules, abnormal sperm maturation and abnormal thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Gstm2 C T 3: 107,984,128 probably null Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Adipor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Adipor2 APN 6 119370168 nonsense probably null
IGL01665:Adipor2 APN 6 119361926 missense probably benign 0.06
IGL01932:Adipor2 APN 6 119361864 missense probably damaging 1.00
IGL02111:Adipor2 APN 6 119370196 nonsense probably null
IGL02540:Adipor2 APN 6 119359495 missense probably benign 0.27
R0764:Adipor2 UTSW 6 119357254 missense probably benign 0.00
R1464:Adipor2 UTSW 6 119361843 missense probably damaging 1.00
R1464:Adipor2 UTSW 6 119361843 missense probably damaging 1.00
R4773:Adipor2 UTSW 6 119359086 missense probably benign 0.04
R5276:Adipor2 UTSW 6 119357221 missense probably damaging 0.98
R6765:Adipor2 UTSW 6 119357242 missense possibly damaging 0.51
R7269:Adipor2 UTSW 6 119370244 missense probably benign
R7477:Adipor2 UTSW 6 119361922 missense probably benign 0.33
R8676:Adipor2 UTSW 6 119363486 critical splice donor site probably benign
R9433:Adipor2 UTSW 6 119359525 missense probably damaging 1.00
Z1177:Adipor2 UTSW 6 119357322 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCATTACTGAAAATCCGAGGGAG -3'
(R):5'- TCTGGGGCTTTGAATTCCTC -3'

Sequencing Primer
(F):5'- ATCCGAGGGAGAGAAATTCTATC -3'
(R):5'- CGTTTTACTGTTCTTAACAAAGCC -3'
Posted On 2016-12-15