Incidental Mutation 'R5791:Pla2g4c'
ID446972
Institutional Source Beutler Lab
Gene Symbol Pla2g4c
Ensembl Gene ENSMUSG00000033847
Gene Namephospholipase A2, group IVC (cytosolic, calcium-independent)
SynonymsCPLA2-gamma
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location13324655-13360672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13339692 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 221 (N221K)
Ref Sequence ENSEMBL: ENSMUSP00000043672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043612] [ENSMUST00000108528] [ENSMUST00000167232]
Predicted Effect probably benign
Transcript: ENSMUST00000043612
AA Change: N221K

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043672
Gene: ENSMUSG00000033847
AA Change: N221K

DomainStartEndE-ValueType
PLAc 1 534 1.97e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108528
AA Change: N231K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104168
Gene: ENSMUSG00000033847
AA Change: N231K

DomainStartEndE-ValueType
PLAc 1 544 1.23e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157290
Predicted Effect probably benign
Transcript: ENSMUST00000167232
AA Change: N231K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000127060
Gene: ENSMUSG00000033847
AA Change: N231K

DomainStartEndE-ValueType
PLAc 1 544 1.23e-8 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the phospholipase A2 enzyme family which hydrolyzes glycerophospholipids to produce free fatty acids and lysophospholipids, both of which serve as precursors in the production of signaling molecules. The encoded protein has been shown to be a calcium-independent and membrane bound enzyme. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Gstm2 C T 3: 107,984,128 probably null Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Pla2g4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Pla2g4c APN 7 13344026 missense probably benign 0.01
IGL00972:Pla2g4c APN 7 13340658 missense probably benign 0.13
IGL01759:Pla2g4c APN 7 13348316 missense probably damaging 1.00
IGL02567:Pla2g4c APN 7 13346040 missense probably damaging 1.00
IGL02629:Pla2g4c APN 7 13335377 nonsense probably null
IGL02719:Pla2g4c APN 7 13330094 missense probably damaging 1.00
IGL02812:Pla2g4c APN 7 13348365 missense probably damaging 1.00
PIT4142001:Pla2g4c UTSW 7 13343391 missense probably benign
R0184:Pla2g4c UTSW 7 13356220 missense probably benign 0.16
R1052:Pla2g4c UTSW 7 13343409 missense possibly damaging 0.95
R1747:Pla2g4c UTSW 7 13337730 splice site probably benign
R4381:Pla2g4c UTSW 7 13346065 missense probably damaging 1.00
R4486:Pla2g4c UTSW 7 13337751 missense probably benign 0.09
R4674:Pla2g4c UTSW 7 13343514 missense probably null 0.24
R4811:Pla2g4c UTSW 7 13337813 missense probably damaging 1.00
R5655:Pla2g4c UTSW 7 13329964 splice site probably null
R5814:Pla2g4c UTSW 7 13340618 missense probably damaging 1.00
R6381:Pla2g4c UTSW 7 13344008 missense probably benign 0.05
R6395:Pla2g4c UTSW 7 13344008 missense probably benign 0.05
R6974:Pla2g4c UTSW 7 13344534 critical splice donor site probably null
R7257:Pla2g4c UTSW 7 13325744 missense possibly damaging 0.46
R7823:Pla2g4c UTSW 7 13330019 missense probably damaging 1.00
Z1088:Pla2g4c UTSW 7 13329753 missense probably benign 0.13
Z1177:Pla2g4c UTSW 7 13348327 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGCTCTCAGACACATGTGGAAG -3'
(R):5'- GGAAGCCCAGATACTTCTCCTTC -3'

Sequencing Primer
(F):5'- AGATCAGTTGGCCCATTGC -3'
(R):5'- CCTTCTCTTCTAGCAATGAAGGAG -3'
Posted On2016-12-15