Mutagenetix > Incidental Mutations

Incidental Mutation 'R5791:Pla2g4c'

446972

Institutional Source

Beutler Lab

Gene Symbol

Pla2g4c

Ensembl Gene

ENSMUSG00000033847

Gene Name

phospholipase A2, group IVC (cytosolic, calcium-independent)

Synonyms

CPLA2-gamma

MMRRC Submission

043207-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R5791 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

13324655-13360672 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 13339692 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 221 (N221K)

Ref Sequence

ENSEMBL: ENSMUSP00000043672 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043612] [ENSMUST00000108528] [ENSMUST00000167232]

Predicted Effect

probably benign
Transcript: ENSMUST00000043612
AA Change: N221K

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000043672
Gene: ENSMUSG00000033847
AA Change: N221K

Domain	Start	End	E-Value	Type
PLAc	1	534	1.97e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108528
AA Change: N231K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000104168
Gene: ENSMUSG00000033847
AA Change: N231K

Domain	Start	End	E-Value	Type
PLAc	1	544	1.23e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157290

Predicted Effect

probably benign
Transcript: ENSMUST00000167232
AA Change: N231K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000127060
Gene: ENSMUSG00000033847
AA Change: N231K

Domain	Start	End	E-Value	Type
PLAc	1	544	1.23e-8	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the phospholipase A2 enzyme family which hydrolyzes glycerophospholipids to produce free fatty acids and lysophospholipids, both of which serve as precursors in the production of signaling molecules. The encoded protein has been shown to be a calcium-independent and membrane bound enzyme. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam25	G	C	8: 40,754,220	Q174H	probably benign	Het
Adipor2	A	T	6: 119,361,905	M129K	possibly damaging	Het
AI314180	C	T	4: 58,814,027	E1360K	possibly damaging	Het
AI314180	T	A	4: 58,822,111	D1152V	probably damaging	Het
Arhgap29	T	A	3: 122,014,245	M616K	probably damaging	Het
Calcrl	A	T	2: 84,351,265	F180I	probably damaging	Het
Cdh4	T	C	2: 179,895,767	V864A	probably damaging	Het
Cep78	A	G	19: 15,961,072	F504S	probably benign	Het
Coasy	A	G	11: 101,084,385		probably null	Het
Dnah3	T	C	7: 119,931,473	N751S	probably benign	Het
Eea1	T	A	10: 96,019,995	N631K	probably benign	Het
Fam149b	A	G	14: 20,351,326	K27R	probably damaging	Het
Fbxw26	A	G	9: 109,745,153	W42R	probably damaging	Het
Gas6	A	G	8: 13,470,217		probably null	Het
Gfral	C	T	9: 76,197,046	R228Q	probably benign	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gmppa	T	C	1: 75,442,255	V324A	possibly damaging	Het
Gstm2	C	T	3: 107,984,128		probably null	Het
Kcng3	A	G	17: 83,588,210	S276P	probably benign	Het
Lrrd1	T	C	5: 3,851,254	S520P	probably benign	Het
Lrrn2	A	G	1: 132,937,767	N190S	probably benign	Het
Lrwd1	G	C	5: 136,131,033	A392G	probably benign	Het
Mab21l2	A	G	3: 86,546,737	Y319H	probably damaging	Het
Ndufv3	A	G	17: 31,527,408	N91D	probably benign	Het
Nfatc2	T	A	2: 168,536,393	M451L	probably benign	Het
Olfr980	A	T	9: 40,006,734	S72T	probably damaging	Het
Pcdhgb2	G	T	18: 37,692,340	V795F	possibly damaging	Het
Pdcd11	T	A	19: 47,110,991	M843K	possibly damaging	Het
Ppox	T	C	1: 171,277,312	Y422C	probably damaging	Het
Retreg3	A	G	11: 101,100,943	S55P	probably damaging	Het
Rnf103	C	A	6: 71,508,925	T180K	probably damaging	Het
Tbl3	A	T	17: 24,704,434	L307H	probably damaging	Het
Tex26	A	T	5: 149,439,775		probably null	Het
Tln2	A	T	9: 67,386,605	I247K	probably damaging	Het
Txlnb	T	C	10: 17,799,128	S10P	probably benign	Het
Vwde	C	A	6: 13,195,986	E347*	probably null	Het
Wasf1	G	A	10: 40,926,574	R75Q	probably damaging	Het
Zfp14	A	G	7: 30,038,262	S433P	probably damaging	Het
Zfp647	G	T	15: 76,918,006	A2E	unknown	Het

Other mutations in Pla2g4c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00953:Pla2g4c	APN	7	13344026	missense	probably benign	0.01
IGL00972:Pla2g4c	APN	7	13340658	missense	probably benign	0.13
IGL01759:Pla2g4c	APN	7	13348316	missense	probably damaging	1.00
IGL02567:Pla2g4c	APN	7	13346040	missense	probably damaging	1.00
IGL02629:Pla2g4c	APN	7	13335377	nonsense	probably null
IGL02719:Pla2g4c	APN	7	13330094	missense	probably damaging	1.00
IGL02812:Pla2g4c	APN	7	13348365	missense	probably damaging	1.00
PIT4142001:Pla2g4c	UTSW	7	13343391	missense	probably benign
R0184:Pla2g4c	UTSW	7	13356220	missense	probably benign	0.16
R1052:Pla2g4c	UTSW	7	13343409	missense	possibly damaging	0.95
R1747:Pla2g4c	UTSW	7	13337730	splice site	probably benign
R4381:Pla2g4c	UTSW	7	13346065	missense	probably damaging	1.00
R4486:Pla2g4c	UTSW	7	13337751	missense	probably benign	0.09
R4674:Pla2g4c	UTSW	7	13343514	missense	probably null	0.24
R4811:Pla2g4c	UTSW	7	13337813	missense	probably damaging	1.00
R5655:Pla2g4c	UTSW	7	13329964	splice site	probably null
R5814:Pla2g4c	UTSW	7	13340618	missense	probably damaging	1.00
R6381:Pla2g4c	UTSW	7	13344008	missense	probably benign	0.05
R6395:Pla2g4c	UTSW	7	13344008	missense	probably benign	0.05
R6974:Pla2g4c	UTSW	7	13344534	critical splice donor site	probably null
R7257:Pla2g4c	UTSW	7	13325744	missense	possibly damaging	0.46
R7823:Pla2g4c	UTSW	7	13330019	missense	probably damaging	1.00
R8385:Pla2g4c	UTSW	7	13329664	missense	probably benign	0.00
R8737:Pla2g4c	UTSW	7	13335229	missense	probably benign	0.15
Z1088:Pla2g4c	UTSW	7	13329753	missense	probably benign	0.13
Z1177:Pla2g4c	UTSW	7	13348327	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GGCTCTCAGACACATGTGGAAG -3'
(R):5'- GGAAGCCCAGATACTTCTCCTTC -3'

Sequencing Primer
(F):5'- AGATCAGTTGGCCCATTGC -3'
(R):5'- CCTTCTCTTCTAGCAATGAAGGAG -3'

Posted On

2016-12-15