Incidental Mutation 'R5791:Fbxw26'
ID446981
Institutional Source Beutler Lab
Gene Symbol Fbxw26
Ensembl Gene ENSMUSG00000059547
Gene NameF-box and WD-40 domain protein 26
SynonymsGm5163
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109717566-109746089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109745153 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 42 (W42R)
Ref Sequence ENSEMBL: ENSMUSP00000071811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071917]
Predicted Effect probably damaging
Transcript: ENSMUST00000071917
AA Change: W42R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071811
Gene: ENSMUSG00000059547
AA Change: W42R

DomainStartEndE-ValueType
FBOX 5 45 2.54e-6 SMART
SCOP:d1tbga_ 128 249 1e-5 SMART
Blast:WD40 137 176 4e-7 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Gstm2 C T 3: 107,984,128 probably null Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Fbxw26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Fbxw26 APN 9 109717948 utr 3 prime probably benign
IGL01072:Fbxw26 APN 9 109723837 missense probably damaging 1.00
IGL01151:Fbxw26 APN 9 109721780 missense possibly damaging 0.50
IGL01394:Fbxw26 APN 9 109717989 missense probably benign 0.00
IGL01432:Fbxw26 APN 9 109717975 missense probably benign 0.32
IGL02559:Fbxw26 APN 9 109722164 missense probably benign 0.34
IGL02981:Fbxw26 APN 9 109744794 missense probably benign 0.09
IGL03370:Fbxw26 APN 9 109746019 missense probably damaging 1.00
R0023:Fbxw26 UTSW 9 109718011 missense probably benign 0.01
R0087:Fbxw26 UTSW 9 109724938 missense probably benign
R0369:Fbxw26 UTSW 9 109723712 critical splice donor site probably null
R0446:Fbxw26 UTSW 9 109743720 missense probably benign 0.03
R1844:Fbxw26 UTSW 9 109724878 missense probably benign 0.42
R1891:Fbxw26 UTSW 9 109722164 missense probably benign 0.34
R2042:Fbxw26 UTSW 9 109732704 missense probably damaging 1.00
R3615:Fbxw26 UTSW 9 109743760 nonsense probably null
R3616:Fbxw26 UTSW 9 109743760 nonsense probably null
R4659:Fbxw26 UTSW 9 109744871 missense probably damaging 0.97
R4785:Fbxw26 UTSW 9 109724800 missense possibly damaging 0.50
R4898:Fbxw26 UTSW 9 109717969 missense possibly damaging 0.95
R5818:Fbxw26 UTSW 9 109732566 missense probably benign
R5921:Fbxw26 UTSW 9 109746018 missense probably damaging 1.00
R5983:Fbxw26 UTSW 9 109717965 missense possibly damaging 0.49
R6145:Fbxw26 UTSW 9 109732623 missense probably benign 0.09
R6209:Fbxw26 UTSW 9 109717965 missense possibly damaging 0.49
R6412:Fbxw26 UTSW 9 109732647 missense probably damaging 0.97
R6842:Fbxw26 UTSW 9 109724920 missense probably damaging 1.00
R7228:Fbxw26 UTSW 9 109724944 missense possibly damaging 0.93
R7451:Fbxw26 UTSW 9 109732623 missense probably benign 0.03
R7467:Fbxw26 UTSW 9 109732697 missense probably benign 0.00
X0020:Fbxw26 UTSW 9 109732632 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAATTGCATTCCCATCAGGC -3'
(R):5'- TTCCTCTGAGCCCTCACAAG -3'

Sequencing Primer
(F):5'- GCATTCCCATCAGGCTGACC -3'
(R):5'- TCTGAGCCCTCACAAGGTGAC -3'
Posted On2016-12-15