Incidental Mutation 'R5791:Wasf1'
ID446983
Institutional Source Beutler Lab
Gene Symbol Wasf1
Ensembl Gene ENSMUSG00000019831
Gene NameWAS protein family, member 1
SynonymsWAVE-1, Scar, WAVE
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.460) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location40883475-40938570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40926574 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 75 (R75Q)
Ref Sequence ENSEMBL: ENSMUSP00000101148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019975] [ENSMUST00000105509]
Predicted Effect probably damaging
Transcript: ENSMUST00000019975
AA Change: R75Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019975
Gene: ENSMUSG00000019831
AA Change: R75Q

DomainStartEndE-ValueType
PDB:4N78|D 1 320 N/A PDB
low complexity region 321 401 N/A INTRINSIC
low complexity region 423 435 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
WH2 497 514 4.32e-5 SMART
low complexity region 544 556 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105509
AA Change: R75Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101148
Gene: ENSMUSG00000019831
AA Change: R75Q

DomainStartEndE-ValueType
PDB:4N78|D 1 320 N/A PDB
low complexity region 321 401 N/A INTRINSIC
low complexity region 423 435 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
WH2 497 514 4.32e-5 SMART
low complexity region 544 556 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the Wiskott-Aldrich syndrome protein (WASP)-family, plays a critical role downstream of Rac, a Rho-family small GTPase, in regulating the actin cytoskeleton required for membrane ruffling. It has been shown to associate with an actin nucleation core Arp2/3 complex while enhancing actin polymerization in vitro. Wiskott-Aldrich syndrome is a disease of the immune system, likely due to defects in regulation of actin cytoskeleton. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this gene has been associated with both morphological and functional defects of the central nervous system. Targeted mutagenesis has resulted in mice that display sensorimotor and cognitive defects similar to those exhibited by patients with 3p-syndrome mental retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Gstm2 C T 3: 107,984,128 probably null Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Wasf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Wasf1 APN 10 40920297 missense probably damaging 1.00
IGL01978:Wasf1 APN 10 40936201 missense unknown
IGL02265:Wasf1 APN 10 40936441 missense unknown
IGL02565:Wasf1 APN 10 40936132 missense possibly damaging 0.70
IGL02741:Wasf1 APN 10 40930709 missense probably damaging 1.00
IGL03037:Wasf1 APN 10 40930658 missense probably benign 0.42
potatoes UTSW 10 40926620 critical splice donor site probably null
K3955:Wasf1 UTSW 10 40936195 missense unknown
R0652:Wasf1 UTSW 10 40931906 splice site probably null
R1276:Wasf1 UTSW 10 40936526 missense unknown
R1774:Wasf1 UTSW 10 40934479 missense possibly damaging 0.50
R1813:Wasf1 UTSW 10 40926589 missense probably damaging 1.00
R3607:Wasf1 UTSW 10 40936384 missense unknown
R4418:Wasf1 UTSW 10 40936582 missense unknown
R4952:Wasf1 UTSW 10 40936190 missense unknown
R4997:Wasf1 UTSW 10 40934604 missense probably damaging 0.96
R5178:Wasf1 UTSW 10 40937676 missense unknown
R5718:Wasf1 UTSW 10 40926574 missense probably damaging 1.00
R5789:Wasf1 UTSW 10 40926574 missense probably damaging 1.00
R5839:Wasf1 UTSW 10 40936319 missense unknown
R6247:Wasf1 UTSW 10 40937745 missense unknown
R6688:Wasf1 UTSW 10 40926620 critical splice donor site probably null
R6889:Wasf1 UTSW 10 40920369 missense probably damaging 1.00
R6977:Wasf1 UTSW 10 40926585 missense probably damaging 0.97
R7023:Wasf1 UTSW 10 40936475 missense unknown
R7136:Wasf1 UTSW 10 40926591 missense possibly damaging 0.91
R7224:Wasf1 UTSW 10 40926550 missense probably benign 0.17
R8558:Wasf1 UTSW 10 40930652 missense possibly damaging 0.88
X0025:Wasf1 UTSW 10 40936697 missense unknown
X0067:Wasf1 UTSW 10 40937657 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCACCAAGGCAGGGTTTAC -3'
(R):5'- CAGGCTGAGCACTCTTACAG -3'

Sequencing Primer
(F):5'- CAGGGTTTACGGTCACTGCTC -3'
(R):5'- GGCTGAGCACTCTTACAGATAATAC -3'
Posted On2016-12-15