Incidental Mutation 'R5791:Coasy'
ID446988
Institutional Source Beutler Lab
Gene Symbol Coasy
Ensembl Gene ENSMUSG00000001755
Gene NameCoenzyme A synthase
SynonymsPpat, 1300003G02Rik, Ukr1, Dpck
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101082565-101086619 bp(+) (GRCm38)
Type of Mutationunclassified (3858 bp from exon)
DNA Base Change (assembly) A to G at 101084385 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000019445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001806] [ENSMUST00000017945] [ENSMUST00000019445] [ENSMUST00000107302] [ENSMUST00000107303] [ENSMUST00000107308] [ENSMUST00000149597]
Predicted Effect probably damaging
Transcript: ENSMUST00000001806
AA Change: D256G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001806
Gene: ENSMUSG00000001755
AA Change: D256G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Pfam:CTP_transf_2 194 338 1.4e-11 PFAM
Pfam:CoaE 358 536 5.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000017945
SMART Domains Protein: ENSMUSP00000017945
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
HLH 135 193 8.13e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000019445
SMART Domains Protein: ENSMUSP00000019445
Gene: ENSMUSG00000019301

DomainStartEndE-ValueType
Pfam:KR 4 174 3.5e-9 PFAM
Pfam:adh_short 4 200 1.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107302
SMART Domains Protein: ENSMUSP00000102923
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
HLH 81 139 8.13e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107303
SMART Domains Protein: ENSMUSP00000102924
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
HLH 51 109 8.13e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107308
AA Change: D256G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102929
Gene: ENSMUSG00000001755
AA Change: D256G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Pfam:CTP_transf_like 194 338 5.3e-11 PFAM
Pfam:CoaE 358 536 1.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149411
Predicted Effect probably benign
Transcript: ENSMUST00000149597
SMART Domains Protein: ENSMUSP00000121600
Gene: ENSMUSG00000017801

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
Pfam:HLH 100 127 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151686
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the bifunctional protein coenzyme A (CoA) synthase which carries out the last two steps in the biosynthesis of CoA from pantothenic acid (vitamin B5). The phosphopantetheine adenylyltransferase domain of this protein catalyzes the conversion of phosphopantetheine into dephospho-CoA while its dephospho-CoA kinase domain completes the final step by phosphorylating dephospho-CoA to form CoA. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Gstm2 C T 3: 107,984,128 probably null Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Coasy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Coasy APN 11 101084358 missense possibly damaging 0.76
IGL02633:Coasy APN 11 101085321 missense probably damaging 1.00
R0946:Coasy UTSW 11 101085870 missense probably damaging 0.96
R1434:Coasy UTSW 11 101084996 unclassified probably benign
R2269:Coasy UTSW 11 101085882 missense probably benign 0.01
R2881:Coasy UTSW 11 101085849 missense possibly damaging 0.90
R5037:Coasy UTSW 11 101084822 missense probably damaging 1.00
R6523:Coasy UTSW 11 101086118 missense probably damaging 1.00
R6696:Coasy UTSW 11 101083101 missense possibly damaging 0.68
R6931:Coasy UTSW 11 101083581 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTGGAGTACACGTCAGCTC -3'
(R):5'- AAGTTCTTCCACCCTGAACC -3'

Sequencing Primer
(F):5'- CGTCAGCTCTCAAAGTGACTGATG -3'
(R):5'- TCTGGGACCACAGCACTTC -3'
Posted On2016-12-15