Incidental Mutation 'R5791:Retreg3'
ID446989
Institutional Source Beutler Lab
Gene Symbol Retreg3
Ensembl Gene ENSMUSG00000017802
Gene Namereticulophagy regulator family member 3
SynonymsFam134c, 1300010M03Rik, 4933404C01Rik
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101096322-101119893 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101100943 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 55 (S55P)
Ref Sequence ENSEMBL: ENSMUSP00000102916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017946] [ENSMUST00000107295]
Predicted Effect probably damaging
Transcript: ENSMUST00000017946
AA Change: S236P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000017946
Gene: ENSMUSG00000017802
AA Change: S236P

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
transmembrane domain 79 101 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
low complexity region 376 397 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107295
AA Change: S55P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102916
Gene: ENSMUSG00000017802
AA Change: S55P

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 195 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154513
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Gstm2 C T 3: 107,984,128 probably null Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Retreg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Retreg3 APN 11 101100925 nonsense probably null
IGL02547:Retreg3 APN 11 101106378 nonsense probably null
IGL03160:Retreg3 APN 11 101099675 missense probably benign 0.03
IGL03405:Retreg3 APN 11 101100969 missense probably damaging 1.00
R0646:Retreg3 UTSW 11 101098629 unclassified probably benign
R1625:Retreg3 UTSW 11 101102049 start codon destroyed probably null
R2215:Retreg3 UTSW 11 101119633 nonsense probably null
R4361:Retreg3 UTSW 11 101103887 splice site probably null
R5586:Retreg3 UTSW 11 101106339 missense probably damaging 1.00
R6026:Retreg3 UTSW 11 101106400 missense probably damaging 0.99
R6179:Retreg3 UTSW 11 101103895 start gained probably benign
R6209:Retreg3 UTSW 11 101119700 missense probably benign 0.27
R6869:Retreg3 UTSW 11 101119818 start gained probably benign
R7553:Retreg3 UTSW 11 101106390 missense possibly damaging 0.86
R7615:Retreg3 UTSW 11 101102980 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTCTGCCTAGGTTTCTC -3'
(R):5'- CCAGGTAAGATTGCTTTGTGC -3'

Sequencing Primer
(F):5'- AGTTACTCCATTGCGAGGAC -3'
(R):5'- TGCAGGGCTGGCGAGATG -3'
Posted On2016-12-15