Incidental Mutation 'R5791:Fam149b'
ID446990
Institutional Source Beutler Lab
Gene Symbol Fam149b
Ensembl Gene ENSMUSG00000039599
Gene Namefamily with sequence similarity 149, member B
Synonyms
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location20348162-20383491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20351326 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 27 (K27R)
Ref Sequence ENSEMBL: ENSMUSP00000153544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022344] [ENSMUST00000037698] [ENSMUST00000051915] [ENSMUST00000090499] [ENSMUST00000090503] [ENSMUST00000223955] [ENSMUST00000224110] [ENSMUST00000224412] [ENSMUST00000224721] [ENSMUST00000224930] [ENSMUST00000225597] [ENSMUST00000225834] [ENSMUST00000225942] [ENSMUST00000225991]
Predicted Effect probably benign
Transcript: ENSMUST00000022344
SMART Domains Protein: ENSMUSP00000022344
Gene: ENSMUSG00000021810

DomainStartEndE-ValueType
Pfam:SGT1 14 597 4.4e-247 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000037698
AA Change: K21R

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045247
Gene: ENSMUSG00000039599
AA Change: K21R

DomainStartEndE-ValueType
Pfam:DUF3719 116 183 2.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051915
AA Change: K21R

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000056907
Gene: ENSMUSG00000039599
AA Change: K21R

DomainStartEndE-ValueType
Pfam:DUF3719 116 183 2.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090499
AA Change: K21R

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000087985
Gene: ENSMUSG00000039599
AA Change: K21R

DomainStartEndE-ValueType
Pfam:DUF3719 116 181 1.5e-28 PFAM
low complexity region 369 383 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090503
AA Change: K21R

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000087989
Gene: ENSMUSG00000039599
AA Change: K21R

DomainStartEndE-ValueType
Pfam:DUF3719 116 157 5.7e-14 PFAM
low complexity region 276 290 N/A INTRINSIC
low complexity region 311 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224079
Predicted Effect probably damaging
Transcript: ENSMUST00000224110
AA Change: K27R

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224242
Predicted Effect probably benign
Transcript: ENSMUST00000224412
Predicted Effect probably benign
Transcript: ENSMUST00000224721
AA Change: K21R

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000224930
AA Change: K21R

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225487
Predicted Effect possibly damaging
Transcript: ENSMUST00000225597
AA Change: K21R

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225834
AA Change: K21R

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000225942
AA Change: K21R

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect unknown
Transcript: ENSMUST00000225991
AA Change: K21R
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Gstm2 C T 3: 107,984,128 probably null Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Fam149b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Fam149b APN 14 20377881 missense possibly damaging 0.78
IGL02323:Fam149b APN 14 20363301 missense possibly damaging 0.94
IGL02631:Fam149b APN 14 20375546 missense probably damaging 0.97
IGL03208:Fam149b APN 14 20351302 splice site probably benign
R0334:Fam149b UTSW 14 20363424 missense probably damaging 0.97
R2511:Fam149b UTSW 14 20378456 missense probably damaging 1.00
R2566:Fam149b UTSW 14 20375510 missense probably damaging 0.97
R4659:Fam149b UTSW 14 20367873 missense probably benign 0.16
R5011:Fam149b UTSW 14 20363371 missense possibly damaging 0.92
R5013:Fam149b UTSW 14 20363371 missense possibly damaging 0.92
R5583:Fam149b UTSW 14 20363300 missense possibly damaging 0.66
R5905:Fam149b UTSW 14 20359910 missense probably benign 0.30
R6035:Fam149b UTSW 14 20377917 missense probably damaging 1.00
R6035:Fam149b UTSW 14 20377917 missense probably damaging 1.00
R7180:Fam149b UTSW 14 20381785 missense probably benign 0.01
R7210:Fam149b UTSW 14 20378472 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGTGGAGGTGAGCATTCC -3'
(R):5'- ACAGGTGTGGTCCGAATGAAC -3'

Sequencing Primer
(F):5'- TTAGTTCCAAACAGGGGCTC -3'
(R):5'- GTGGTCCGAATGAACAAACCCTTTG -3'
Posted On2016-12-15