Incidental Mutation 'R5791:Ndufv3'
ID446993
Institutional Source Beutler Lab
Gene Symbol Ndufv3
Ensembl Gene ENSMUSG00000024038
Gene NameNADH dehydrogenase (ubiquinone) flavoprotein 3
Synonyms1500032D16Rik
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location31520115-31531326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31527408 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 91 (N91D)
Ref Sequence ENSEMBL: ENSMUSP00000049000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046288] [ENSMUST00000064798] [ENSMUST00000191598]
Predicted Effect probably benign
Transcript: ENSMUST00000046288
AA Change: N91D

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049000
Gene: ENSMUSG00000024038
AA Change: N91D

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
low complexity region 80 88 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
Pfam:NDUFV3 427 461 1.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064798
SMART Domains Protein: ENSMUSP00000066303
Gene: ENSMUSG00000024038

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189436
Predicted Effect probably benign
Transcript: ENSMUST00000191598
SMART Domains Protein: ENSMUSP00000140032
Gene: ENSMUSG00000024038

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193280
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of at least forty-one subunits that make up the NADH-ubiquinone oxidoreductase complex. This complex is part of the mitochondrial respiratory chain and serves to catalyze the rotenone-sensitive oxidation of NADH and the reduction of ubiquinone. The encoded protein is one of three proteins found in the flavoprotein fraction of the complex. The specific function of the encoded protein is unknown. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Gstm2 C T 3: 107,984,128 probably null Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Ndufv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Ndufv3 APN 17 31527486 missense possibly damaging 0.92
IGL01974:Ndufv3 APN 17 31521609 missense probably benign 0.00
IGL02616:Ndufv3 APN 17 31527669 missense probably damaging 0.98
R1823:Ndufv3 UTSW 17 31531245 missense probably damaging 0.96
R1824:Ndufv3 UTSW 17 31531245 missense probably damaging 0.96
R2095:Ndufv3 UTSW 17 31527486 missense possibly damaging 0.92
R4852:Ndufv3 UTSW 17 31528069 missense probably benign
R5914:Ndufv3 UTSW 17 31531232 nonsense probably null
R7081:Ndufv3 UTSW 17 31527433 missense possibly damaging 0.80
R7570:Ndufv3 UTSW 17 31527622 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACGCAATGAAATGTCTGTGGC -3'
(R):5'- CCCCATCAGAATCTGAATCTGAG -3'

Sequencing Primer
(F):5'- CAATGAAATGTCTGTGGCTTTGAG -3'
(R):5'- CATCAGAATCTGAATCTGAGGAGCTG -3'
Posted On2016-12-15