Incidental Mutation 'R5791:Kcng3'
ID446994
Institutional Source Beutler Lab
Gene Symbol Kcng3
Ensembl Gene ENSMUSG00000045053
Gene Namepotassium voltage-gated channel, subfamily G, member 3
SynonymsKv10.1a, Kv10.1b, KV6.3
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location83585957-83631895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83588210 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 276 (S276P)
Ref Sequence ENSEMBL: ENSMUSP00000054910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051482]
Predicted Effect probably benign
Transcript: ENSMUST00000051482
AA Change: S276P

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000054910
Gene: ENSMUSG00000045053
AA Change: S276P

DomainStartEndE-ValueType
BTB 9 119 5.2e-5 SMART
Pfam:Ion_trans 167 417 4.6e-42 PFAM
Pfam:Ion_trans_2 321 411 4.3e-13 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member is a gamma subunit functioning as a modulatory molecule. Alternative splicing results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Gstm2 C T 3: 107,984,128 probably null Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Kcng3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Kcng3 APN 17 83587850 missense probably damaging 1.00
PIT4403001:Kcng3 UTSW 17 83588182 missense probably damaging 1.00
R0034:Kcng3 UTSW 17 83588383 splice site probably benign
R0056:Kcng3 UTSW 17 83587756 missense probably damaging 0.98
R0335:Kcng3 UTSW 17 83587737 missense possibly damaging 0.51
R1224:Kcng3 UTSW 17 83631395 missense probably damaging 1.00
R1462:Kcng3 UTSW 17 83631063 missense probably damaging 0.96
R1601:Kcng3 UTSW 17 83588339 missense probably damaging 1.00
R3147:Kcng3 UTSW 17 83588320 missense possibly damaging 0.71
R4854:Kcng3 UTSW 17 83588306 missense probably damaging 0.97
R5408:Kcng3 UTSW 17 83631005 missense probably benign 0.12
R5719:Kcng3 UTSW 17 83631134 missense possibly damaging 0.71
R6155:Kcng3 UTSW 17 83588378 missense probably benign
R6437:Kcng3 UTSW 17 83631129 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGCGAAATCCTTGTTG -3'
(R):5'- TGACAGGATAATTGAAGCTATCTGC -3'

Sequencing Primer
(F):5'- TGCACTAAAGATTGCCATGGC -3'
(R):5'- AAGCTATCTGCATAGGGTGGTTCAC -3'
Posted On2016-12-15