Incidental Mutation 'R5791:Pcdhgb2'
ID446995
Institutional Source Beutler Lab
Gene Symbol Pcdhgb2
Ensembl Gene ENSMUSG00000102748
Gene Nameprotocadherin gamma subfamily B, 2
Synonyms
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37689828-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 37692340 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 795 (V795F)
Ref Sequence ENSEMBL: ENSMUSP00000141449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192931] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000195112]
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193631
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000195112
AA Change: V795F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748
AA Change: V795F

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195163
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Gstm2 C T 3: 107,984,128 probably null Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Pcdhgb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2906:Pcdhgb2 UTSW 18 37690855 missense probably damaging 1.00
R3081:Pcdhgb2 UTSW 18 37691513 missense probably damaging 1.00
R3780:Pcdhgb2 UTSW 18 37691757 missense probably damaging 1.00
R4095:Pcdhgb2 UTSW 18 37690950 missense probably benign 0.01
R4258:Pcdhgb2 UTSW 18 37692049 missense probably damaging 1.00
R4261:Pcdhgb2 UTSW 18 37691897 missense probably damaging 1.00
R4695:Pcdhgb2 UTSW 18 37692322 missense probably benign 0.00
R4741:Pcdhgb2 UTSW 18 37691684 splice site probably null
R4824:Pcdhgb2 UTSW 18 37690449 missense probably damaging 1.00
R4852:Pcdhgb2 UTSW 18 37692050 missense probably damaging 1.00
R4858:Pcdhgb2 UTSW 18 37692100 missense probably benign 0.22
R4933:Pcdhgb2 UTSW 18 37692214 missense probably benign 0.07
R5240:Pcdhgb2 UTSW 18 37691050 missense possibly damaging 0.87
R5973:Pcdhgb2 UTSW 18 37690507 missense probably benign 0.00
R6059:Pcdhgb2 UTSW 18 37690025 nonsense probably null
R6217:Pcdhgb2 UTSW 18 37690001 missense possibly damaging 0.71
R6903:Pcdhgb2 UTSW 18 37692170 missense possibly damaging 0.94
R6953:Pcdhgb2 UTSW 18 37690754 missense possibly damaging 0.95
R7150:Pcdhgb2 UTSW 18 37692247 missense possibly damaging 0.89
R7214:Pcdhgb2 UTSW 18 37690106 missense probably damaging 1.00
R7453:Pcdhgb2 UTSW 18 37691015 missense probably damaging 0.96
R7728:Pcdhgb2 UTSW 18 37691207 missense probably damaging 1.00
R7754:Pcdhgb2 UTSW 18 37689970 missense probably benign 0.23
R7846:Pcdhgb2 UTSW 18 37692220 missense possibly damaging 0.88
R8001:Pcdhgb2 UTSW 18 37690634 missense probably benign 0.06
R8079:Pcdhgb2 UTSW 18 37690763 missense probably damaging 1.00
R8438:Pcdhgb2 UTSW 18 37692179 missense probably benign 0.20
Z1177:Pcdhgb2 UTSW 18 37692148 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACCTGGCCTCAGCTCTAAC -3'
(R):5'- AACCCTTCTGTAAGACGTGG -3'

Sequencing Primer
(F):5'- AACCTTGCGACTGGAGTTC -3'
(R):5'- CGTGGTTGGATAAGGCTAACATAC -3'
Posted On2016-12-15