Incidental Mutation 'R5791:Cep78'
ID446996
Institutional Source Beutler Lab
Gene Symbol Cep78
Ensembl Gene ENSMUSG00000041491
Gene Namecentrosomal protein 78
Synonyms5730599I05Rik
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.785) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location15955774-15984989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15961072 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 504 (F504S)
Ref Sequence ENSEMBL: ENSMUSP00000037596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047704]
Predicted Effect probably benign
Transcript: ENSMUST00000047704
AA Change: F504S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000037596
Gene: ENSMUSG00000041491
AA Change: F504S

DomainStartEndE-ValueType
LRR 152 179 2.95e-3 SMART
Blast:LRR 180 207 1e-10 BLAST
LRR 231 259 6.28e-1 SMART
LRR 260 287 8.81e-2 SMART
LRR 288 313 1.96e2 SMART
low complexity region 427 450 N/A INTRINSIC
coiled coil region 462 511 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Gstm2 C T 3: 107,984,128 probably null Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Olfr980 A T 9: 40,006,734 S72T probably damaging Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Cep78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Cep78 APN 19 15969140 missense probably benign
IGL00920:Cep78 APN 19 15981486 missense probably benign 0.03
IGL01548:Cep78 APN 19 15981200 splice site probably benign
IGL01662:Cep78 APN 19 15960995 missense probably damaging 1.00
IGL01933:Cep78 APN 19 15955940 missense probably benign
IGL02014:Cep78 APN 19 15984738 missense probably damaging 1.00
IGL02198:Cep78 APN 19 15956369 missense probably damaging 1.00
IGL02331:Cep78 APN 19 15974415 missense probably benign 0.16
IGL02431:Cep78 APN 19 15959579 missense probably benign
IGL02731:Cep78 APN 19 15956306 missense probably benign 0.02
IGL03268:Cep78 APN 19 15974442 nonsense probably null
IGL03338:Cep78 APN 19 15959623 missense probably damaging 0.97
himalayas UTSW 19 15969128 missense possibly damaging 0.66
R0426:Cep78 UTSW 19 15970970 nonsense probably null
R0619:Cep78 UTSW 19 15978862 missense probably damaging 0.99
R0659:Cep78 UTSW 19 15956190 missense probably damaging 0.97
R1517:Cep78 UTSW 19 15959663 missense probably damaging 1.00
R1758:Cep78 UTSW 19 15959536 missense probably damaging 1.00
R1836:Cep78 UTSW 19 15969169 missense probably damaging 1.00
R1865:Cep78 UTSW 19 15956004 missense probably damaging 1.00
R1920:Cep78 UTSW 19 15974351 splice site probably benign
R2483:Cep78 UTSW 19 15960980 missense probably damaging 1.00
R2958:Cep78 UTSW 19 15978909 missense probably damaging 1.00
R3814:Cep78 UTSW 19 15981802 critical splice acceptor site probably null
R4133:Cep78 UTSW 19 15969155 missense probably damaging 1.00
R4214:Cep78 UTSW 19 15959579 missense probably benign
R5783:Cep78 UTSW 19 15956359 missense probably benign 0.02
R5910:Cep78 UTSW 19 15969128 missense possibly damaging 0.66
R5924:Cep78 UTSW 19 15961066 missense probably damaging 1.00
R6148:Cep78 UTSW 19 15981786 nonsense probably null
R6162:Cep78 UTSW 19 15974940 missense probably benign 0.28
R6235:Cep78 UTSW 19 15976486 splice site probably null
R6968:Cep78 UTSW 19 15981738 missense probably benign 0.38
R7228:Cep78 UTSW 19 15969197 missense probably benign 0.01
R7913:Cep78 UTSW 19 15970577 missense probably benign
R7914:Cep78 UTSW 19 15976308 missense probably benign 0.30
R7934:Cep78 UTSW 19 15956390 missense probably damaging 0.96
R8059:Cep78 UTSW 19 15981512 missense probably benign 0.02
R8146:Cep78 UTSW 19 15956363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGGCAAGCTACAATTAAAGC -3'
(R):5'- GTGTCTCCAGTGAAGATCATTATG -3'

Sequencing Primer
(F):5'- GCTACAATTAAAGCCACTGAAGAATG -3'
(R):5'- CCAGTGAAGATCATTATGTGTTATGG -3'
Posted On2016-12-15