Mutagenetix > Incidental Mutation

Incidental Mutation 'R5792:Axdnd1'

447002

Institutional Source

Beutler Lab

Gene Symbol

Axdnd1

Ensembl Gene

ENSMUSG00000026601

Gene Name

axonemal dynein light chain domain containing 1

Synonyms

LOC381304, 9430070O13Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R5792 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

156323509-156421159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 156341889 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 802 (E802D)

Ref Sequence

ENSEMBL: ENSMUSP00000148420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000212747] [ENSMUST00000213088]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000177824

SMART Domains

Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601

Domain	Start	End	E-Value	Type
Pfam:Ax_dynein_light	131	314	2.4e-12	PFAM
low complexity region	405	414	N/A	INTRINSIC
low complexity region	452	464	N/A	INTRINSIC
low complexity region	666	677	N/A	INTRINSIC
coiled coil region	787	837	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178036
AA Change: E802D

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: E802D

Domain	Start	End	E-Value	Type
Pfam:Ax_dynein_light	196	380	3.3e-14	PFAM
low complexity region	470	479	N/A	INTRINSIC
low complexity region	517	529	N/A	INTRINSIC
low complexity region	731	742	N/A	INTRINSIC
coiled coil region	889	939	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212342

Predicted Effect

probably benign
Transcript: ENSMUST00000212747

Predicted Effect

probably damaging
Transcript: ENSMUST00000213088
AA Change: E802D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Meta Mutation Damage Score

0.1542

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

95% (56/59)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,521	I296F	possibly damaging	Het
Adamts19	C	T	18: 58,837,512	T56M	possibly damaging	Het
Armc4	T	C	18: 7,217,965	N583S	probably benign	Het
Birc6	T	C	17: 74,631,053	V2630A	probably benign	Het
Capn5	A	T	7: 98,131,195	F323I	probably benign	Het
Cdc25b	A	G	2: 131,191,759	E206G	probably damaging	Het
Cmah	T	G	13: 24,456,915	N382K	probably benign	Het
Col11a1	A	T	3: 114,131,593	D25V	probably damaging	Het
Cyp2d41-ps	G	T	15: 82,779,220		noncoding transcript	Het
Cyp3a59	A	G	5: 146,099,851	K288E	possibly damaging	Het
Cyr61	T	C	3: 145,648,658	D166G	probably benign	Het
Dclre1a	A	C	19: 56,529,590	I1019S	probably damaging	Het
Fat2	G	T	11: 55,262,325	A3687D	possibly damaging	Het
Flg2	T	A	3: 93,203,497	V944E	unknown	Het
Galntl5	T	C	5: 25,198,463	V177A	possibly damaging	Het
Gm12695	T	C	4: 96,728,283	T438A	probably benign	Het
Gm14295	A	T	2: 176,811,014	N766Y	probably benign	Het
Gm15433	T	A	1: 84,964,112		noncoding transcript	Het
Gm2431	C	T	7: 142,258,332	G8E	unknown	Het
Gm5435	T	A	12: 82,495,426		noncoding transcript	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Grip1	T	C	10: 119,985,480	I350T	probably benign	Het
Guf1	T	A	5: 69,560,486	F196I	probably damaging	Het
Kcng4	G	T	8: 119,626,279	D297E	probably damaging	Het
Khdrbs2	G	A	1: 32,472,692	R246Q	probably damaging	Het
Layn	T	C	9: 51,068,161	E148G	probably damaging	Het
Lrig3	T	A	10: 126,009,919	V739E	probably damaging	Het
Lyg1	A	G	1: 37,947,267	W129R	probably benign	Het
Nup210l	C	T	3: 90,199,857	T1567I	probably damaging	Het
Nus1	T	A	10: 52,429,256	L12*	probably null	Het
Olfr2	A	T	7: 107,001,443	V139D	possibly damaging	Het
Olfr354	A	G	2: 36,907,101	I52V	probably benign	Het
Otop1	A	G	5: 38,297,916	N218S	probably benign	Het
Pcif1	T	A	2: 164,885,379	N90K	probably damaging	Het
Phf2	T	C	13: 48,820,042		probably null	Het
Piezo2	T	A	18: 63,146,856	I215F	probably damaging	Het
Pitpnm2	G	T	5: 124,130,321	C553*	probably null	Het
Prdm1	A	G	10: 44,450,228	V115A	probably damaging	Het
Prkdc	A	G	16: 15,816,752	D3587G	probably damaging	Het
Sez6l	A	T	5: 112,422,024	Y883*	probably null	Het
Sh3rf2	A	C	18: 42,111,138	H223P	probably damaging	Het
Slco1a5	C	T	6: 142,242,113	C500Y	probably damaging	Het
Slf1	T	A	13: 77,066,737	H610L	probably benign	Het
Syn3	T	C	10: 86,294,628	*244W	probably null	Het
Sytl2	A	T	7: 90,375,689	D295V	probably damaging	Het
Tnfrsf1a	T	A	6: 125,358,077	C44S	probably damaging	Het
Ttc6	T	G	12: 57,673,204	L854V	possibly damaging	Het
Ttn	T	C	2: 76,766,258	I18358V	probably benign	Het
Vmn2r108	A	G	17: 20,463,136	V602A	probably damaging	Het
Zap70	A	G	1: 36,779,009		probably benign	Het
Zfhx2	T	C	14: 55,066,846	E1227G	possibly damaging	Het
Znhit3	G	A	11: 84,916,084		probably null	Het
Zpbp2	A	G	11: 98,551,410		probably benign	Het

Other mutations in Axdnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03058:Axdnd1	APN	1	156376663	missense	probably benign	0.41
IGL03075:Axdnd1	APN	1	156395442	missense	probably damaging	1.00
IGL03165:Axdnd1	APN	1	156378389	missense	probably benign	0.00
R0164:Axdnd1	UTSW	1	156378386	missense	possibly damaging	0.93
R0164:Axdnd1	UTSW	1	156378386	missense	possibly damaging	0.93
R0739:Axdnd1	UTSW	1	156380886	missense	possibly damaging	0.73
R1087:Axdnd1	UTSW	1	156365689	missense	probably benign	0.08
R1350:Axdnd1	UTSW	1	156378380	critical splice donor site	probably null
R1488:Axdnd1	UTSW	1	156348960	missense	probably damaging	1.00
R1493:Axdnd1	UTSW	1	156346701	missense	probably benign	0.03
R1845:Axdnd1	UTSW	1	156376544	missense	possibly damaging	0.58
R1900:Axdnd1	UTSW	1	156380774	splice site	probably null
R2126:Axdnd1	UTSW	1	156333214	missense	probably benign	0.03
R2163:Axdnd1	UTSW	1	156392003	missense	probably damaging	1.00
R2169:Axdnd1	UTSW	1	156418309	missense	probably damaging	1.00
R2380:Axdnd1	UTSW	1	156365651	missense	probably benign	0.02
R2568:Axdnd1	UTSW	1	156392749	missense	possibly damaging	0.90
R3052:Axdnd1	UTSW	1	156341870	missense	probably damaging	0.96
R3053:Axdnd1	UTSW	1	156341870	missense	probably damaging	0.96
R3767:Axdnd1	UTSW	1	156380858	missense	probably damaging	1.00
R3927:Axdnd1	UTSW	1	156419270	missense	probably damaging	1.00
R3936:Axdnd1	UTSW	1	156331639	missense	probably benign	0.01
R4829:Axdnd1	UTSW	1	156376646	missense	possibly damaging	0.93
R4882:Axdnd1	UTSW	1	156395559	splice site	probably null
R4969:Axdnd1	UTSW	1	156395505	missense	possibly damaging	0.95
R5091:Axdnd1	UTSW	1	156420410	missense	possibly damaging	0.83
R5510:Axdnd1	UTSW	1	156335350	missense	probably benign	0.03
R5549:Axdnd1	UTSW	1	156398534	missense	probably damaging	1.00
R5587:Axdnd1	UTSW	1	156351412	missense	probably damaging	1.00
R5840:Axdnd1	UTSW	1	156348958	missense	probably damaging	1.00
R6187:Axdnd1	UTSW	1	156365612	splice site	probably null
R6208:Axdnd1	UTSW	1	156392856	intron	probably benign
R6369:Axdnd1	UTSW	1	156392745	missense	probably damaging	1.00
R6493:Axdnd1	UTSW	1	156380813	missense	probably damaging	1.00
R7014:Axdnd1	UTSW	1	156330962	splice site	probably null
R7115:Axdnd1	UTSW	1	156380876	missense
R7203:Axdnd1	UTSW	1	156382389	missense	probably damaging	0.98
R7352:Axdnd1	UTSW	1	156382477	missense	possibly damaging	0.91
R7447:Axdnd1	UTSW	1	156418232	critical splice donor site	probably null
R7470:Axdnd1	UTSW	1	156376516	missense
R7686:Axdnd1	UTSW	1	156395464	nonsense	probably null
R7793:Axdnd1	UTSW	1	156338743	critical splice donor site	probably null
R7809:Axdnd1	UTSW	1	156392801	nonsense	probably null
R7882:Axdnd1	UTSW	1	156397453	missense
R8256:Axdnd1	UTSW	1	156330666	missense	unknown
R8348:Axdnd1	UTSW	1	156418284	missense	probably benign	0.02
R8971:Axdnd1	UTSW	1	156391946	missense
R9207:Axdnd1	UTSW	1	156388046	missense
R9294:Axdnd1	UTSW	1	156420347	nonsense	probably null
X0009:Axdnd1	UTSW	1	156388079	missense	possibly damaging	0.61
X0067:Axdnd1	UTSW	1	156376535	missense	possibly damaging	0.67
Z1176:Axdnd1	UTSW	1	156349063	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTAGGTACCCTGAGATGCAG -3'
(R):5'- ATAAGCCCTGTAAGCGAGGC -3'

Sequencing Primer
(F):5'- GAACCTGAGTGTGACCTTACTAAG -3'
(R):5'- CGGGGTGTGATTAGGCCTAC -3'

Posted On

2016-12-15