Mutagenetix > Incidental Mutations

Incidental Mutation 'R5792:Col11a1'

447010

Institutional Source

Beutler Lab

Gene Symbol

Col11a1

Ensembl Gene

ENSMUSG00000027966

Gene Name

collagen, type XI, alpha 1

Synonyms

C530001D20Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.880) question?

Stock #

R5792 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114030540-114220718 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 114131593 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 25 (D25V)

Ref Sequence

ENSEMBL: ENSMUSP00000148798 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092155] [ENSMUST00000211802]

Predicted Effect

unknown
Transcript: ENSMUST00000092155
AA Change: D808V

SMART Domains

Protein: ENSMUSP00000089793
Gene: ENSMUSG00000027966
AA Change: D808V

Domain	Start	End	E-Value	Type
TSPN	37	228	1.83e-62	SMART
LamG	96	227	5.87e-11	SMART
low complexity region	256	276	N/A	INTRINSIC
internal_repeat_4	357	431	3.12e-6	PROSPERO
Pfam:Collagen	433	491	2.6e-9	PFAM
Pfam:Collagen	525	586	5.9e-9	PFAM
low complexity region	611	632	N/A	INTRINSIC
low complexity region	638	677	N/A	INTRINSIC
Pfam:Collagen	721	805	3.6e-8	PFAM
internal_repeat_3	814	854	3.55e-9	PROSPERO
internal_repeat_1	818	869	2.01e-16	PROSPERO
low complexity region	872	944	N/A	INTRINSIC
low complexity region	952	1001	N/A	INTRINSIC
low complexity region	1031	1059	N/A	INTRINSIC
low complexity region	1066	1100	N/A	INTRINSIC
low complexity region	1103	1121	N/A	INTRINSIC
internal_repeat_2	1124	1188	2.4e-12	PROSPERO
low complexity region	1189	1205	N/A	INTRINSIC
low complexity region	1211	1232	N/A	INTRINSIC
low complexity region	1235	1250	N/A	INTRINSIC
low complexity region	1252	1368	N/A	INTRINSIC
low complexity region	1373	1392	N/A	INTRINSIC
low complexity region	1417	1448	N/A	INTRINSIC
low complexity region	1453	1463	N/A	INTRINSIC
Pfam:Collagen	1481	1543	8.3e-9	PFAM
COLFI	1574	1803	7.28e-127	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000211802
AA Change: D25V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.2582

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

95% (56/59)

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XI collagen, one of the low abundance fibrillar collagens that is essential for normal embryonic skeletal development and the cohesive properties of cartilage. The encoded protein, in association with the alpha-1 subunit of type II collagen, forms a heterotrimeric type XI procollagen that undergoes proteolytic processing. Mice lacking the encoded protein develop severe chondrodysplasia and die at birth. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality by asphyxia. Mutants animals display weak tracheal cartilage, short snout, short mandible, cleft palate, short limbs, and externally rotated distal portion of the hindlimbs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,521	I296F	possibly damaging	Het
Adamts19	C	T	18: 58,837,512	T56M	possibly damaging	Het
Armc4	T	C	18: 7,217,965	N583S	probably benign	Het
Axdnd1	T	G	1: 156,341,889	E802D	probably damaging	Het
Birc6	T	C	17: 74,631,053	V2630A	probably benign	Het
Capn5	A	T	7: 98,131,195	F323I	probably benign	Het
Cdc25b	A	G	2: 131,191,759	E206G	probably damaging	Het
Cmah	T	G	13: 24,456,915	N382K	probably benign	Het
Cyp2d41-ps	G	T	15: 82,779,220		noncoding transcript	Het
Cyp3a59	A	G	5: 146,099,851	K288E	possibly damaging	Het
Cyr61	T	C	3: 145,648,658	D166G	probably benign	Het
Dclre1a	A	C	19: 56,529,590	I1019S	probably damaging	Het
Fat2	G	T	11: 55,262,325	A3687D	possibly damaging	Het
Flg2	T	A	3: 93,203,497	V944E	unknown	Het
Galntl5	T	C	5: 25,198,463	V177A	possibly damaging	Het
Gm12695	T	C	4: 96,728,283	T438A	probably benign	Het
Gm14295	A	T	2: 176,811,014	N766Y	probably benign	Het
Gm15433	T	A	1: 84,964,112		noncoding transcript	Het
Gm2431	C	T	7: 142,258,332	G8E	unknown	Het
Gm5435	T	A	12: 82,495,426		noncoding transcript	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Grip1	T	C	10: 119,985,480	I350T	probably benign	Het
Guf1	T	A	5: 69,560,486	F196I	probably damaging	Het
Kcng4	G	T	8: 119,626,279	D297E	probably damaging	Het
Khdrbs2	G	A	1: 32,472,692	R246Q	probably damaging	Het
Layn	T	C	9: 51,068,161	E148G	probably damaging	Het
Lrig3	T	A	10: 126,009,919	V739E	probably damaging	Het
Lyg1	A	G	1: 37,947,267	W129R	probably benign	Het
Nup210l	C	T	3: 90,199,857	T1567I	probably damaging	Het
Nus1	T	A	10: 52,429,256	L12*	probably null	Het
Olfr2	A	T	7: 107,001,443	V139D	possibly damaging	Het
Olfr354	A	G	2: 36,907,101	I52V	probably benign	Het
Otop1	A	G	5: 38,297,916	N218S	probably benign	Het
Pcif1	T	A	2: 164,885,379	N90K	probably damaging	Het
Phf2	T	C	13: 48,820,042		probably null	Het
Piezo2	T	A	18: 63,146,856	I215F	probably damaging	Het
Pitpnm2	G	T	5: 124,130,321	C553*	probably null	Het
Prdm1	A	G	10: 44,450,228	V115A	probably damaging	Het
Prkdc	A	G	16: 15,816,752	D3587G	probably damaging	Het
Sez6l	A	T	5: 112,422,024	Y883*	probably null	Het
Sh3rf2	A	C	18: 42,111,138	H223P	probably damaging	Het
Slco1a5	C	T	6: 142,242,113	C500Y	probably damaging	Het
Slf1	T	A	13: 77,066,737	H610L	probably benign	Het
Syn3	T	C	10: 86,294,628	*244W	probably null	Het
Sytl2	A	T	7: 90,375,689	D295V	probably damaging	Het
Tnfrsf1a	T	A	6: 125,358,077	C44S	probably damaging	Het
Ttc6	T	G	12: 57,673,204	L854V	possibly damaging	Het
Ttn	T	C	2: 76,766,258	I18358V	probably benign	Het
Vmn2r108	A	G	17: 20,463,136	V602A	probably damaging	Het
Zap70	A	G	1: 36,779,009		probably benign	Het
Zfhx2	T	C	14: 55,066,846	E1227G	possibly damaging	Het
Znhit3	G	A	11: 84,916,084		probably null	Het
Zpbp2	A	G	11: 98,551,410		probably benign	Het

Other mutations in Col11a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Col11a1	APN	3	114066533	missense	unknown
IGL00578:Col11a1	APN	3	114194106	missense	possibly damaging	0.95
IGL00742:Col11a1	APN	3	114124315	missense	unknown
IGL01014:Col11a1	APN	3	114123809	splice site	probably benign
IGL01099:Col11a1	APN	3	114112041	nonsense	probably null
IGL01129:Col11a1	APN	3	114185873	splice site	probably benign
IGL01474:Col11a1	APN	3	114217134	utr 3 prime	probably benign
IGL01884:Col11a1	APN	3	114066542	missense	unknown
IGL02104:Col11a1	APN	3	114181397	critical splice donor site	probably null
IGL02715:Col11a1	APN	3	114129409	missense	probably benign	0.06
IGL02978:Col11a1	APN	3	114061562	missense	unknown
IGL03203:Col11a1	APN	3	114212084	missense	possibly damaging	0.91
IGL03240:Col11a1	APN	3	114217210	splice site	probably null
IGL03357:Col11a1	APN	3	114194091	missense	probably damaging	1.00
IGL03390:Col11a1	APN	3	114090253	missense	unknown
gluon	UTSW	3	114217170	utr 3 prime	probably benign
uncovered	UTSW	3	114112467	unclassified	probably benign
R0110:Col11a1	UTSW	3	114105456	splice site	probably benign
R0144:Col11a1	UTSW	3	114113594	missense	unknown
R0432:Col11a1	UTSW	3	114205901	splice site	probably benign
R0468:Col11a1	UTSW	3	114217058	utr 3 prime	probably benign
R0510:Col11a1	UTSW	3	114105456	splice site	probably benign
R0535:Col11a1	UTSW	3	114061535	missense	unknown
R0608:Col11a1	UTSW	3	114218715	utr 3 prime	probably benign
R0826:Col11a1	UTSW	3	114138765	missense	unknown
R0827:Col11a1	UTSW	3	114138765	missense	unknown
R0862:Col11a1	UTSW	3	114138765	missense	unknown
R0863:Col11a1	UTSW	3	114138765	missense	unknown
R0926:Col11a1	UTSW	3	114090180	missense	unknown
R0980:Col11a1	UTSW	3	114138765	missense	unknown
R0981:Col11a1	UTSW	3	114138765	missense	unknown
R1004:Col11a1	UTSW	3	114095022	splice site	probably benign
R1037:Col11a1	UTSW	3	114194152	missense	probably damaging	1.00
R1171:Col11a1	UTSW	3	114066564	missense	unknown
R1316:Col11a1	UTSW	3	114138970	splice site	probably null
R1324:Col11a1	UTSW	3	114030916	missense	unknown
R1338:Col11a1	UTSW	3	114216995	utr 3 prime	probably benign
R1513:Col11a1	UTSW	3	114097154	missense	unknown
R1528:Col11a1	UTSW	3	114216995	utr 3 prime	probably benign
R1567:Col11a1	UTSW	3	114138612	missense	unknown
R1596:Col11a1	UTSW	3	114152613	utr 3 prime	probably benign
R1605:Col11a1	UTSW	3	114131641	missense	probably damaging	1.00
R1624:Col11a1	UTSW	3	114158155	missense	probably damaging	0.97
R1626:Col11a1	UTSW	3	114131569	missense	probably damaging	1.00
R1666:Col11a1	UTSW	3	114061535	missense	unknown
R1806:Col11a1	UTSW	3	114158142	missense	probably damaging	1.00
R2001:Col11a1	UTSW	3	114165293	splice site	probably null
R2084:Col11a1	UTSW	3	114158142	missense	probably damaging	1.00
R2085:Col11a1	UTSW	3	114158142	missense	probably damaging	1.00
R3926:Col11a1	UTSW	3	114090124	splice site	probably benign
R3950:Col11a1	UTSW	3	114121445	critical splice donor site	probably null
R3970:Col11a1	UTSW	3	114097189	missense	unknown
R4171:Col11a1	UTSW	3	114208214	missense	probably damaging	0.99
R4175:Col11a1	UTSW	3	114208223	missense	possibly damaging	0.83
R4176:Col11a1	UTSW	3	114208223	missense	possibly damaging	0.83
R4413:Col11a1	UTSW	3	114108316	missense	unknown
R4540:Col11a1	UTSW	3	114097166	missense	unknown
R5210:Col11a1	UTSW	3	114153157	missense	probably damaging	1.00
R5250:Col11a1	UTSW	3	114217170	utr 3 prime	probably benign
R5335:Col11a1	UTSW	3	114095240	missense	unknown
R5344:Col11a1	UTSW	3	114208362	critical splice donor site	probably null
R5394:Col11a1	UTSW	3	114194184	splice site	probably null
R5687:Col11a1	UTSW	3	114217103	utr 3 prime	probably benign
R5708:Col11a1	UTSW	3	114097094	missense	unknown
R5763:Col11a1	UTSW	3	114094596	intron	probably benign
R6259:Col11a1	UTSW	3	114138447	missense	probably benign
R6679:Col11a1	UTSW	3	114152719	splice site	probably null
R6738:Col11a1	UTSW	3	114112467	unclassified	probably benign
R6747:Col11a1	UTSW	3	114212450	nonsense	probably null
R6808:Col11a1	UTSW	3	114094944	missense	possibly damaging	0.87
R6861:Col11a1	UTSW	3	114167492	missense	probably damaging	1.00
R7201:Col11a1	UTSW	3	114090157	missense	unknown
R7264:Col11a1	UTSW	3	114185599	missense	unknown
R7393:Col11a1	UTSW	3	114097106	missense	unknown
R7445:Col11a1	UTSW	3	114193929	missense	unknown
R7479:Col11a1	UTSW	3	114102569	missense	unknown
R7548:Col11a1	UTSW	3	114123760	missense	unknown
R7683:Col11a1	UTSW	3	114113736	missense	unknown
R7747:Col11a1	UTSW	3	114102572	missense	unknown
R7809:Col11a1	UTSW	3	114097186	missense	unknown
R7951:Col11a1	UTSW	3	114095215	missense	unknown
R8057:Col11a1	UTSW	3	114131614	missense	unknown
R8134:Col11a1	UTSW	3	114218786	missense	unknown
R8139:Col11a1	UTSW	3	114097049	missense	unknown
R8243:Col11a1	UTSW	3	114061492	missense	unknown
R8324:Col11a1	UTSW	3	114164410	missense	probably damaging	1.00
R8346:Col11a1	UTSW	3	114212169	missense	unknown
R8480:Col11a1	UTSW	3	114181394
RF002:Col11a1	UTSW	3	114217001	missense	unknown
X0018:Col11a1	UTSW	3	114112233	unclassified	probably benign
Z1177:Col11a1	UTSW	3	114138921	missense	unknown
Z1177:Col11a1	UTSW	3	114165235	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTTTCTCAAAAGTAGGCAAAACAGC -3'
(R):5'- GTCTCTAGTGATCACAAAGCAATCTG -3'

Sequencing Primer
(F):5'- AGCAAACGAAACATAATGCAATG -3'
(R):5'- GATCACAAAGCAATCTGTATTCTACG -3'

Posted On

2016-12-15