Mutagenetix > Incidental Mutations

Incidental Mutation 'R5792:Gm12695'

447012

Institutional Source

Beutler Lab

Gene Symbol

Gm12695

Ensembl Gene

ENSMUSG00000078639

Gene Name

predicted gene 12695

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R5792 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96723647-96785186 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 96728283 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 438 (T438A)

Ref Sequence

ENSEMBL: ENSMUSP00000102686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107071]

Predicted Effect

probably benign
Transcript: ENSMUST00000107071
AA Change: T438A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000102686
Gene: ENSMUSG00000078639
AA Change: T438A

Domain	Start	End	E-Value	Type
low complexity region	226	237	N/A	INTRINSIC
low complexity region	360	371	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

95% (56/59)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,521	I296F	possibly damaging	Het
Adamts19	C	T	18: 58,837,512	T56M	possibly damaging	Het
Armc4	T	C	18: 7,217,965	N583S	probably benign	Het
Axdnd1	T	G	1: 156,341,889	E802D	probably damaging	Het
Birc6	T	C	17: 74,631,053	V2630A	probably benign	Het
Capn5	A	T	7: 98,131,195	F323I	probably benign	Het
Cdc25b	A	G	2: 131,191,759	E206G	probably damaging	Het
Cmah	T	G	13: 24,456,915	N382K	probably benign	Het
Col11a1	A	T	3: 114,131,593	D25V	probably damaging	Het
Cyp2d41-ps	G	T	15: 82,779,220		noncoding transcript	Het
Cyp3a59	A	G	5: 146,099,851	K288E	possibly damaging	Het
Cyr61	T	C	3: 145,648,658	D166G	probably benign	Het
Dclre1a	A	C	19: 56,529,590	I1019S	probably damaging	Het
Fat2	G	T	11: 55,262,325	A3687D	possibly damaging	Het
Flg2	T	A	3: 93,203,497	V944E	unknown	Het
Galntl5	T	C	5: 25,198,463	V177A	possibly damaging	Het
Gm14295	A	T	2: 176,811,014	N766Y	probably benign	Het
Gm15433	T	A	1: 84,964,112		noncoding transcript	Het
Gm2431	C	T	7: 142,258,332	G8E	unknown	Het
Gm5435	T	A	12: 82,495,426		noncoding transcript	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Grip1	T	C	10: 119,985,480	I350T	probably benign	Het
Guf1	T	A	5: 69,560,486	F196I	probably damaging	Het
Kcng4	G	T	8: 119,626,279	D297E	probably damaging	Het
Khdrbs2	G	A	1: 32,472,692	R246Q	probably damaging	Het
Layn	T	C	9: 51,068,161	E148G	probably damaging	Het
Lrig3	T	A	10: 126,009,919	V739E	probably damaging	Het
Lyg1	A	G	1: 37,947,267	W129R	probably benign	Het
Nup210l	C	T	3: 90,199,857	T1567I	probably damaging	Het
Nus1	T	A	10: 52,429,256	L12*	probably null	Het
Olfr2	A	T	7: 107,001,443	V139D	possibly damaging	Het
Olfr354	A	G	2: 36,907,101	I52V	probably benign	Het
Otop1	A	G	5: 38,297,916	N218S	probably benign	Het
Pcif1	T	A	2: 164,885,379	N90K	probably damaging	Het
Phf2	T	C	13: 48,820,042		probably null	Het
Piezo2	T	A	18: 63,146,856	I215F	probably damaging	Het
Pitpnm2	G	T	5: 124,130,321	C553*	probably null	Het
Prdm1	A	G	10: 44,450,228	V115A	probably damaging	Het
Prkdc	A	G	16: 15,816,752	D3587G	probably damaging	Het
Sez6l	A	T	5: 112,422,024	Y883*	probably null	Het
Sh3rf2	A	C	18: 42,111,138	H223P	probably damaging	Het
Slco1a5	C	T	6: 142,242,113	C500Y	probably damaging	Het
Slf1	T	A	13: 77,066,737	H610L	probably benign	Het
Syn3	T	C	10: 86,294,628	*244W	probably null	Het
Sytl2	A	T	7: 90,375,689	D295V	probably damaging	Het
Tnfrsf1a	T	A	6: 125,358,077	C44S	probably damaging	Het
Ttc6	T	G	12: 57,673,204	L854V	possibly damaging	Het
Ttn	T	C	2: 76,766,258	I18358V	probably benign	Het
Vmn2r108	A	G	17: 20,463,136	V602A	probably damaging	Het
Zap70	A	G	1: 36,779,009		probably benign	Het
Zfhx2	T	C	14: 55,066,846	E1227G	possibly damaging	Het
Znhit3	G	A	11: 84,916,084		probably null	Het
Zpbp2	A	G	11: 98,551,410		probably benign	Het

Other mutations in Gm12695

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Gm12695	APN	4	96749182	missense	probably damaging	1.00
IGL01016:Gm12695	APN	4	96757947	missense	probably benign	0.03
IGL02605:Gm12695	APN	4	96762751	missense	probably null	0.92
IGL02734:Gm12695	APN	4	96724030	nonsense	probably null
IGL02869:Gm12695	APN	4	96762133	splice site	probably benign
IGL02895:Gm12695	APN	4	96723949	missense	probably damaging	0.99
R0020:Gm12695	UTSW	4	96769735	missense	probably damaging	0.96
R0465:Gm12695	UTSW	4	96785075	missense	probably damaging	1.00
R0941:Gm12695	UTSW	4	96728217	nonsense	probably null
R0968:Gm12695	UTSW	4	96762066	missense	probably damaging	1.00
R1965:Gm12695	UTSW	4	96762845	missense	probably benign	0.16
R1983:Gm12695	UTSW	4	96738977	missense	possibly damaging	0.84
R2051:Gm12695	UTSW	4	96769771	missense	probably damaging	0.99
R2063:Gm12695	UTSW	4	96769726	missense	probably benign	0.14
R2064:Gm12695	UTSW	4	96769726	missense	probably benign	0.14
R2065:Gm12695	UTSW	4	96769726	missense	probably benign	0.14
R2066:Gm12695	UTSW	4	96769726	missense	probably benign	0.14
R2067:Gm12695	UTSW	4	96769726	missense	probably benign	0.14
R2073:Gm12695	UTSW	4	96723945	missense	possibly damaging	0.76
R2075:Gm12695	UTSW	4	96723945	missense	possibly damaging	0.76
R2233:Gm12695	UTSW	4	96724029	missense	probably damaging	1.00
R2234:Gm12695	UTSW	4	96724029	missense	probably damaging	1.00
R2327:Gm12695	UTSW	4	96769656	missense	probably benign	0.00
R2507:Gm12695	UTSW	4	96754189	missense	probably damaging	0.99
R3836:Gm12695	UTSW	4	96762097	missense	probably damaging	0.99
R4685:Gm12695	UTSW	4	96761980	missense	probably damaging	1.00
R5491:Gm12695	UTSW	4	96769668	missense	possibly damaging	0.84
R6767:Gm12695	UTSW	4	96762696	splice site	probably null
R6786:Gm12695	UTSW	4	96762821	missense	probably damaging	1.00
R6874:Gm12695	UTSW	4	96785069	missense	probably benign	0.04
R6923:Gm12695	UTSW	4	96769816	missense	probably benign	0.00
R6978:Gm12695	UTSW	4	96769722	missense	possibly damaging	0.69
R7810:Gm12695	UTSW	4	96731371	missense	probably damaging	0.99
R8263:Gm12695	UTSW	4	96762809	missense	probably benign	0.00
R8272:Gm12695	UTSW	4	96723946	missense	possibly damaging	0.76
R8285:Gm12695	UTSW	4	96769753	missense	possibly damaging	0.76
Z1177:Gm12695	UTSW	4	96749223	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAAAACTGGGTTGGTGGTC -3'
(R):5'- TGACAGTTAGAGCTGCCAAATATG -3'

Sequencing Primer
(F):5'- GGAATTCATACCTTACCTGTGTTG -3'
(R):5'- GCTGCCAAATATGTAAGATTCCTCC -3'

Posted On

2016-12-15