Incidental Mutation 'R5792:Otop1'
ID447014
Institutional Source Beutler Lab
Gene Symbol Otop1
Ensembl Gene ENSMUSG00000051596
Gene Nameotopetrin 1
Synonymstlt, A530025J20Rik
Accession Numbers

NCBI RefSeq: NM_172709.3; MGI:2388363

Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5792 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location38275972-38304217 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38297916 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 218 (N218S)
Ref Sequence ENSEMBL: ENSMUSP00000109734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063136] [ENSMUST00000114099]
Predicted Effect probably benign
Transcript: ENSMUST00000063136
AA Change: N215S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000061805
Gene: ENSMUSG00000051596
AA Change: N215S

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
transmembrane domain 87 106 N/A INTRINSIC
Pfam:Otopetrin 127 239 1.6e-13 PFAM
Pfam:Otopetrin 240 456 1.9e-16 PFAM
low complexity region 462 471 N/A INTRINSIC
Pfam:Otopetrin 518 583 3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114099
AA Change: N218S

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109734
Gene: ENSMUSG00000051596
AA Change: N218S

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
Pfam:Otopetrin 130 457 3.1e-40 PFAM
low complexity region 466 475 N/A INTRINSIC
Pfam:Otopetrin 513 587 2.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187863
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (56/59)
MGI Phenotype Strain: 4881519; 2655558; 1856638; 4950042
PHENOTYPE: Homozygous mutant mice display vestibular abnormalities associated with absent otoconia. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Spontaneous(1) Chemically induced(2)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,521 I296F possibly damaging Het
Adamts19 C T 18: 58,837,512 T56M possibly damaging Het
Armc4 T C 18: 7,217,965 N583S probably benign Het
Axdnd1 T G 1: 156,341,889 E802D probably damaging Het
Birc6 T C 17: 74,631,053 V2630A probably benign Het
Capn5 A T 7: 98,131,195 F323I probably benign Het
Cdc25b A G 2: 131,191,759 E206G probably damaging Het
Cmah T G 13: 24,456,915 N382K probably benign Het
Col11a1 A T 3: 114,131,593 D25V probably damaging Het
Cyp2d41-ps G T 15: 82,779,220 noncoding transcript Het
Cyp3a59 A G 5: 146,099,851 K288E possibly damaging Het
Cyr61 T C 3: 145,648,658 D166G probably benign Het
Dclre1a A C 19: 56,529,590 I1019S probably damaging Het
Fat2 G T 11: 55,262,325 A3687D possibly damaging Het
Flg2 T A 3: 93,203,497 V944E unknown Het
Galntl5 T C 5: 25,198,463 V177A possibly damaging Het
Gm12695 T C 4: 96,728,283 T438A probably benign Het
Gm14295 A T 2: 176,811,014 N766Y probably benign Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm2431 C T 7: 142,258,332 G8E unknown Het
Gm5435 T A 12: 82,495,426 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grip1 T C 10: 119,985,480 I350T probably benign Het
Guf1 T A 5: 69,560,486 F196I probably damaging Het
Kcng4 G T 8: 119,626,279 D297E probably damaging Het
Khdrbs2 G A 1: 32,472,692 R246Q probably damaging Het
Layn T C 9: 51,068,161 E148G probably damaging Het
Lrig3 T A 10: 126,009,919 V739E probably damaging Het
Lyg1 A G 1: 37,947,267 W129R probably benign Het
Nup210l C T 3: 90,199,857 T1567I probably damaging Het
Nus1 T A 10: 52,429,256 L12* probably null Het
Olfr2 A T 7: 107,001,443 V139D possibly damaging Het
Olfr354 A G 2: 36,907,101 I52V probably benign Het
Pcif1 T A 2: 164,885,379 N90K probably damaging Het
Phf2 T C 13: 48,820,042 probably null Het
Piezo2 T A 18: 63,146,856 I215F probably damaging Het
Pitpnm2 G T 5: 124,130,321 C553* probably null Het
Prdm1 A G 10: 44,450,228 V115A probably damaging Het
Prkdc A G 16: 15,816,752 D3587G probably damaging Het
Sez6l A T 5: 112,422,024 Y883* probably null Het
Sh3rf2 A C 18: 42,111,138 H223P probably damaging Het
Slco1a5 C T 6: 142,242,113 C500Y probably damaging Het
Slf1 T A 13: 77,066,737 H610L probably benign Het
Syn3 T C 10: 86,294,628 *244W probably null Het
Sytl2 A T 7: 90,375,689 D295V probably damaging Het
Tnfrsf1a T A 6: 125,358,077 C44S probably damaging Het
Ttc6 T G 12: 57,673,204 L854V possibly damaging Het
Ttn T C 2: 76,766,258 I18358V probably benign Het
Vmn2r108 A G 17: 20,463,136 V602A probably damaging Het
Zap70 A G 1: 36,779,009 probably benign Het
Zfhx2 T C 14: 55,066,846 E1227G possibly damaging Het
Znhit3 G A 11: 84,916,084 probably null Het
Zpbp2 A G 11: 98,551,410 probably benign Het
Other mutations in Otop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Otop1 APN 5 38302845 missense probably damaging 1.00
IGL01793:Otop1 APN 5 38299871 missense possibly damaging 0.89
IGL02071:Otop1 APN 5 38287983 missense probably damaging 1.00
IGL02111:Otop1 APN 5 38277701 missense probably benign 0.01
IGL02660:Otop1 APN 5 38288005 missense probably damaging 0.99
IGL02672:Otop1 APN 5 38277826 critical splice donor site probably null
IGL03164:Otop1 APN 5 38287962 nonsense probably null
BB008:Otop1 UTSW 5 38288020 missense probably damaging 1.00
BB018:Otop1 UTSW 5 38288020 missense probably damaging 1.00
P0015:Otop1 UTSW 5 38294559 splice site probably benign
R0092:Otop1 UTSW 5 38299830 missense probably damaging 0.97
R0639:Otop1 UTSW 5 38287948 missense possibly damaging 0.77
R0670:Otop1 UTSW 5 38287948 missense possibly damaging 0.77
R0673:Otop1 UTSW 5 38287948 missense possibly damaging 0.77
R2092:Otop1 UTSW 5 38299766 missense probably damaging 1.00
R2105:Otop1 UTSW 5 38300458 missense probably benign
R2152:Otop1 UTSW 5 38302851 missense probably damaging 1.00
R3971:Otop1 UTSW 5 38300189 missense probably benign 0.04
R3972:Otop1 UTSW 5 38300189 missense probably benign 0.04
R4575:Otop1 UTSW 5 38299721 missense probably damaging 1.00
R4660:Otop1 UTSW 5 38300024 missense possibly damaging 0.95
R4998:Otop1 UTSW 5 38294548 critical splice donor site probably null
R5412:Otop1 UTSW 5 38297984 missense probably benign 0.25
R5461:Otop1 UTSW 5 38299715 missense probably damaging 1.00
R5607:Otop1 UTSW 5 38294504 missense possibly damaging 0.68
R5625:Otop1 UTSW 5 38302761 missense probably damaging 1.00
R5677:Otop1 UTSW 5 38300163 missense probably damaging 1.00
R5878:Otop1 UTSW 5 38277822 missense possibly damaging 0.73
R6163:Otop1 UTSW 5 38287890 splice site probably null
R7338:Otop1 UTSW 5 38300203 nonsense probably null
R7931:Otop1 UTSW 5 38288020 missense probably damaging 1.00
R7994:Otop1 UTSW 5 38299851 missense probably benign 0.02
R8224:Otop1 UTSW 5 38300503 missense possibly damaging 0.79
X0064:Otop1 UTSW 5 38299751 missense probably damaging 1.00
Z1177:Otop1 UTSW 5 38277770 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTGGACCAATGGCTGAAAG -3'
(R):5'- GGTGAAGCCTATAATTACTCCCTTG -3'

Sequencing Primer
(F):5'- CTGGACCAATGGCTGAAAGAAGAG -3'
(R):5'- AGCCTATAATTACTCCCTTGGAAAG -3'
Posted On2016-12-15