Mutagenetix > Incidental Mutations

Incidental Mutation 'R5792:Guf1'

447015

Institutional Source

Beutler Lab

Gene Symbol

Guf1

Ensembl Gene

ENSMUSG00000029208

Gene Name

GUF1 homolog, GTPase

Synonyms

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.777) question?

Stock #

R5792 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69556923-69575973 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 69560486 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 196 (F196I)

Ref Sequence

ENSEMBL: ENSMUSP00000144246 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031113] [ENSMUST00000087228] [ENSMUST00000132169] [ENSMUST00000144363] [ENSMUST00000154728] [ENSMUST00000173205]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031113
AA Change: F196I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000031113
Gene: ENSMUSG00000029208
AA Change: F196I

Domain	Start	End	E-Value	Type
low complexity region	7	29	N/A	INTRINSIC
Pfam:GTP_EFTU	48	227	2.9e-53	PFAM
Pfam:MMR_HSR1	52	177	1.1e-7	PFAM
Pfam:Ras	83	227	2.4e-7	PFAM
low complexity region	336	349	N/A	INTRINSIC
EFG_C	364	450	9.13e-1	SMART
Pfam:LepA_C	452	559	3.1e-48	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000087228
AA Change: F196I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000084480
Gene: ENSMUSG00000029208
AA Change: F196I

Domain	Start	End	E-Value	Type
low complexity region	7	29	N/A	INTRINSIC
Pfam:GTP_EFTU	48	227	3.1e-54	PFAM
Pfam:MMR_HSR1	52	177	4.1e-6	PFAM
Pfam:Ras	83	226	2.9e-7	PFAM
Pfam:GTP_EFTU_D2	250	320	7e-10	PFAM
low complexity region	424	437	N/A	INTRINSIC
EFG_C	452	538	9.13e-1	SMART
Pfam:LepA_C	540	646	1.3e-48	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125543

Predicted Effect

probably damaging
Transcript: ENSMUST00000132169
AA Change: F196I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144290
Gene: ENSMUSG00000029208
AA Change: F196I

Domain	Start	End	E-Value	Type
low complexity region	7	29	N/A	INTRINSIC
Pfam:GTP_EFTU	48	227	6.2e-54	PFAM
Pfam:MMR_HSR1	52	177	6.2e-6	PFAM
Pfam:Ras	83	226	1.2e-6	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000144363
AA Change: F190I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114707
Gene: ENSMUSG00000029208
AA Change: F190I

Domain	Start	End	E-Value	Type
low complexity region	1	23	N/A	INTRINSIC
Pfam:GTP_EFTU	42	221	5.8e-54	PFAM
Pfam:MMR_HSR1	46	171	5.9e-6	PFAM
Pfam:Ras	77	220	1.1e-6	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000154728
AA Change: F196I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144246
Gene: ENSMUSG00000029208
AA Change: F196I

Domain	Start	End	E-Value	Type
low complexity region	7	29	N/A	INTRINSIC
Pfam:GTP_EFTU	48	227	6.2e-54	PFAM
Pfam:MMR_HSR1	52	177	6.2e-6	PFAM
Pfam:Ras	83	226	1.2e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173205
AA Change: F183I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000133467
Gene: ENSMUSG00000029208
AA Change: F183I

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	11	190	1.1e-53	PFAM
Pfam:MMR_HSR1	15	140	2.6e-8	PFAM
Pfam:Ras	46	190	1.6e-7	PFAM
Pfam:GTP_EFTU_D2	213	283	3.1e-9	PFAM
Pfam:EFG_C	369	454	1e-16	PFAM
Pfam:LepA_C	455	562	4.5e-50	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201115

Meta Mutation Damage Score

0.1880

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

95% (56/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase that triggers back-translocation of the elongating ribosome during mitochondrial protein synthesis. The protein contains a highly conserved C-terminal domain not found in other GTPases that facilitates tRNA binding. The encoded protein is thought to prevent misincorporation of amino acids in stressful, suboptimal conditions. An allelic variant in this gene has been associated with early infantile epileptic encephalopathy-40. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,521	I296F	possibly damaging	Het
Adamts19	C	T	18: 58,837,512	T56M	possibly damaging	Het
Armc4	T	C	18: 7,217,965	N583S	probably benign	Het
Axdnd1	T	G	1: 156,341,889	E802D	probably damaging	Het
Birc6	T	C	17: 74,631,053	V2630A	probably benign	Het
Capn5	A	T	7: 98,131,195	F323I	probably benign	Het
Cdc25b	A	G	2: 131,191,759	E206G	probably damaging	Het
Cmah	T	G	13: 24,456,915	N382K	probably benign	Het
Col11a1	A	T	3: 114,131,593	D25V	probably damaging	Het
Cyp2d41-ps	G	T	15: 82,779,220		noncoding transcript	Het
Cyp3a59	A	G	5: 146,099,851	K288E	possibly damaging	Het
Cyr61	T	C	3: 145,648,658	D166G	probably benign	Het
Dclre1a	A	C	19: 56,529,590	I1019S	probably damaging	Het
Fat2	G	T	11: 55,262,325	A3687D	possibly damaging	Het
Flg2	T	A	3: 93,203,497	V944E	unknown	Het
Galntl5	T	C	5: 25,198,463	V177A	possibly damaging	Het
Gm12695	T	C	4: 96,728,283	T438A	probably benign	Het
Gm14295	A	T	2: 176,811,014	N766Y	probably benign	Het
Gm15433	T	A	1: 84,964,112		noncoding transcript	Het
Gm2431	C	T	7: 142,258,332	G8E	unknown	Het
Gm5435	T	A	12: 82,495,426		noncoding transcript	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Grip1	T	C	10: 119,985,480	I350T	probably benign	Het
Kcng4	G	T	8: 119,626,279	D297E	probably damaging	Het
Khdrbs2	G	A	1: 32,472,692	R246Q	probably damaging	Het
Layn	T	C	9: 51,068,161	E148G	probably damaging	Het
Lrig3	T	A	10: 126,009,919	V739E	probably damaging	Het
Lyg1	A	G	1: 37,947,267	W129R	probably benign	Het
Nup210l	C	T	3: 90,199,857	T1567I	probably damaging	Het
Nus1	T	A	10: 52,429,256	L12*	probably null	Het
Olfr2	A	T	7: 107,001,443	V139D	possibly damaging	Het
Olfr354	A	G	2: 36,907,101	I52V	probably benign	Het
Otop1	A	G	5: 38,297,916	N218S	probably benign	Het
Pcif1	T	A	2: 164,885,379	N90K	probably damaging	Het
Phf2	T	C	13: 48,820,042		probably null	Het
Piezo2	T	A	18: 63,146,856	I215F	probably damaging	Het
Pitpnm2	G	T	5: 124,130,321	C553*	probably null	Het
Prdm1	A	G	10: 44,450,228	V115A	probably damaging	Het
Prkdc	A	G	16: 15,816,752	D3587G	probably damaging	Het
Sez6l	A	T	5: 112,422,024	Y883*	probably null	Het
Sh3rf2	A	C	18: 42,111,138	H223P	probably damaging	Het
Slco1a5	C	T	6: 142,242,113	C500Y	probably damaging	Het
Slf1	T	A	13: 77,066,737	H610L	probably benign	Het
Syn3	T	C	10: 86,294,628	*244W	probably null	Het
Sytl2	A	T	7: 90,375,689	D295V	probably damaging	Het
Tnfrsf1a	T	A	6: 125,358,077	C44S	probably damaging	Het
Ttc6	T	G	12: 57,673,204	L854V	possibly damaging	Het
Ttn	T	C	2: 76,766,258	I18358V	probably benign	Het
Vmn2r108	A	G	17: 20,463,136	V602A	probably damaging	Het
Zap70	A	G	1: 36,779,009		probably benign	Het
Zfhx2	T	C	14: 55,066,846	E1227G	possibly damaging	Het
Znhit3	G	A	11: 84,916,084		probably null	Het
Zpbp2	A	G	11: 98,551,410		probably benign	Het

Other mutations in Guf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01580:Guf1	APN	5	69565421	splice site	probably benign
IGL01739:Guf1	APN	5	69561158	missense	probably damaging	1.00
IGL03110:Guf1	APN	5	69558477	missense	probably damaging	1.00
R0054:Guf1	UTSW	5	69559561	synonymous	silent
R0219:Guf1	UTSW	5	69559586	missense	probably damaging	1.00
R0269:Guf1	UTSW	5	69559599	missense	probably damaging	0.99
R0624:Guf1	UTSW	5	69558580	missense	probably damaging	1.00
R0690:Guf1	UTSW	5	69566352	splice site	probably null
R0906:Guf1	UTSW	5	69566386	missense	probably damaging	0.99
R1082:Guf1	UTSW	5	69567212	missense	possibly damaging	0.95
R1386:Guf1	UTSW	5	69563162	missense	probably benign
R1506:Guf1	UTSW	5	69567166	missense	possibly damaging	0.85
R1859:Guf1	UTSW	5	69568460	nonsense	probably null
R1982:Guf1	UTSW	5	69567226	nonsense	probably null
R3782:Guf1	UTSW	5	69567152	missense	probably benign	0.01
R3847:Guf1	UTSW	5	69561157	missense	probably damaging	0.99
R4172:Guf1	UTSW	5	69558229	missense	possibly damaging	0.88
R4513:Guf1	UTSW	5	69561662	missense	probably benign	0.00
R4592:Guf1	UTSW	5	69566443	missense	possibly damaging	0.55
R4811:Guf1	UTSW	5	69564509	splice site	probably null
R5435:Guf1	UTSW	5	69563169	missense	probably benign	0.01
R6181:Guf1	UTSW	5	69561716	missense	probably damaging	1.00
R6246:Guf1	UTSW	5	69558555	missense	probably damaging	1.00
R6411:Guf1	UTSW	5	69560511	missense	possibly damaging	0.87
R6701:Guf1	UTSW	5	69558253	missense	probably damaging	1.00
R6724:Guf1	UTSW	5	69566393	missense	probably damaging	0.99
R7634:Guf1	UTSW	5	69564544	missense	probably damaging	0.97
R7923:Guf1	UTSW	5	69561159	missense	probably benign	0.01
R8202:Guf1	UTSW	5	69563202	missense	possibly damaging	0.95
R8387:Guf1	UTSW	5	69566467	missense	probably damaging	1.00
X0018:Guf1	UTSW	5	69566366	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTTGGTATACTCTGTTCTGCTTAC -3'
(R):5'- TTTCAGTTAGGTCAATCTCCTGAG -3'

Sequencing Primer
(F):5'- CCTTTTGGCTAAGATCAAGTGTAATC -3'
(R):5'- AGTATGCAGCACCTTCATGG -3'

Posted On

2016-12-15