Incidental Mutation 'R5792:Guf1'
ID447015
Institutional Source Beutler Lab
Gene Symbol Guf1
Ensembl Gene ENSMUSG00000029208
Gene NameGUF1 homolog, GTPase
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R5792 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location69556923-69575973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69560486 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 196 (F196I)
Ref Sequence ENSEMBL: ENSMUSP00000144246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031113] [ENSMUST00000087228] [ENSMUST00000132169] [ENSMUST00000144363] [ENSMUST00000154728] [ENSMUST00000173205]
Predicted Effect probably damaging
Transcript: ENSMUST00000031113
AA Change: F196I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031113
Gene: ENSMUSG00000029208
AA Change: F196I

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 2.9e-53 PFAM
Pfam:MMR_HSR1 52 177 1.1e-7 PFAM
Pfam:Ras 83 227 2.4e-7 PFAM
low complexity region 336 349 N/A INTRINSIC
EFG_C 364 450 9.13e-1 SMART
Pfam:LepA_C 452 559 3.1e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087228
AA Change: F196I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084480
Gene: ENSMUSG00000029208
AA Change: F196I

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 3.1e-54 PFAM
Pfam:MMR_HSR1 52 177 4.1e-6 PFAM
Pfam:Ras 83 226 2.9e-7 PFAM
Pfam:GTP_EFTU_D2 250 320 7e-10 PFAM
low complexity region 424 437 N/A INTRINSIC
EFG_C 452 538 9.13e-1 SMART
Pfam:LepA_C 540 646 1.3e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125543
Predicted Effect probably damaging
Transcript: ENSMUST00000132169
AA Change: F196I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144290
Gene: ENSMUSG00000029208
AA Change: F196I

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 6.2e-54 PFAM
Pfam:MMR_HSR1 52 177 6.2e-6 PFAM
Pfam:Ras 83 226 1.2e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144363
AA Change: F190I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114707
Gene: ENSMUSG00000029208
AA Change: F190I

DomainStartEndE-ValueType
low complexity region 1 23 N/A INTRINSIC
Pfam:GTP_EFTU 42 221 5.8e-54 PFAM
Pfam:MMR_HSR1 46 171 5.9e-6 PFAM
Pfam:Ras 77 220 1.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154728
AA Change: F196I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144246
Gene: ENSMUSG00000029208
AA Change: F196I

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 6.2e-54 PFAM
Pfam:MMR_HSR1 52 177 6.2e-6 PFAM
Pfam:Ras 83 226 1.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173205
AA Change: F183I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133467
Gene: ENSMUSG00000029208
AA Change: F183I

DomainStartEndE-ValueType
Pfam:GTP_EFTU 11 190 1.1e-53 PFAM
Pfam:MMR_HSR1 15 140 2.6e-8 PFAM
Pfam:Ras 46 190 1.6e-7 PFAM
Pfam:GTP_EFTU_D2 213 283 3.1e-9 PFAM
Pfam:EFG_C 369 454 1e-16 PFAM
Pfam:LepA_C 455 562 4.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201115
Meta Mutation Damage Score 0.1880 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (56/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase that triggers back-translocation of the elongating ribosome during mitochondrial protein synthesis. The protein contains a highly conserved C-terminal domain not found in other GTPases that facilitates tRNA binding. The encoded protein is thought to prevent misincorporation of amino acids in stressful, suboptimal conditions. An allelic variant in this gene has been associated with early infantile epileptic encephalopathy-40. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,521 I296F possibly damaging Het
Adamts19 C T 18: 58,837,512 T56M possibly damaging Het
Armc4 T C 18: 7,217,965 N583S probably benign Het
Axdnd1 T G 1: 156,341,889 E802D probably damaging Het
Birc6 T C 17: 74,631,053 V2630A probably benign Het
Capn5 A T 7: 98,131,195 F323I probably benign Het
Cdc25b A G 2: 131,191,759 E206G probably damaging Het
Cmah T G 13: 24,456,915 N382K probably benign Het
Col11a1 A T 3: 114,131,593 D25V probably damaging Het
Cyp2d41-ps G T 15: 82,779,220 noncoding transcript Het
Cyp3a59 A G 5: 146,099,851 K288E possibly damaging Het
Cyr61 T C 3: 145,648,658 D166G probably benign Het
Dclre1a A C 19: 56,529,590 I1019S probably damaging Het
Fat2 G T 11: 55,262,325 A3687D possibly damaging Het
Flg2 T A 3: 93,203,497 V944E unknown Het
Galntl5 T C 5: 25,198,463 V177A possibly damaging Het
Gm12695 T C 4: 96,728,283 T438A probably benign Het
Gm14295 A T 2: 176,811,014 N766Y probably benign Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm2431 C T 7: 142,258,332 G8E unknown Het
Gm5435 T A 12: 82,495,426 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grip1 T C 10: 119,985,480 I350T probably benign Het
Kcng4 G T 8: 119,626,279 D297E probably damaging Het
Khdrbs2 G A 1: 32,472,692 R246Q probably damaging Het
Layn T C 9: 51,068,161 E148G probably damaging Het
Lrig3 T A 10: 126,009,919 V739E probably damaging Het
Lyg1 A G 1: 37,947,267 W129R probably benign Het
Nup210l C T 3: 90,199,857 T1567I probably damaging Het
Nus1 T A 10: 52,429,256 L12* probably null Het
Olfr2 A T 7: 107,001,443 V139D possibly damaging Het
Olfr354 A G 2: 36,907,101 I52V probably benign Het
Otop1 A G 5: 38,297,916 N218S probably benign Het
Pcif1 T A 2: 164,885,379 N90K probably damaging Het
Phf2 T C 13: 48,820,042 probably null Het
Piezo2 T A 18: 63,146,856 I215F probably damaging Het
Pitpnm2 G T 5: 124,130,321 C553* probably null Het
Prdm1 A G 10: 44,450,228 V115A probably damaging Het
Prkdc A G 16: 15,816,752 D3587G probably damaging Het
Sez6l A T 5: 112,422,024 Y883* probably null Het
Sh3rf2 A C 18: 42,111,138 H223P probably damaging Het
Slco1a5 C T 6: 142,242,113 C500Y probably damaging Het
Slf1 T A 13: 77,066,737 H610L probably benign Het
Syn3 T C 10: 86,294,628 *244W probably null Het
Sytl2 A T 7: 90,375,689 D295V probably damaging Het
Tnfrsf1a T A 6: 125,358,077 C44S probably damaging Het
Ttc6 T G 12: 57,673,204 L854V possibly damaging Het
Ttn T C 2: 76,766,258 I18358V probably benign Het
Vmn2r108 A G 17: 20,463,136 V602A probably damaging Het
Zap70 A G 1: 36,779,009 probably benign Het
Zfhx2 T C 14: 55,066,846 E1227G possibly damaging Het
Znhit3 G A 11: 84,916,084 probably null Het
Zpbp2 A G 11: 98,551,410 probably benign Het
Other mutations in Guf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01580:Guf1 APN 5 69565421 splice site probably benign
IGL01739:Guf1 APN 5 69561158 missense probably damaging 1.00
IGL03110:Guf1 APN 5 69558477 missense probably damaging 1.00
R0054:Guf1 UTSW 5 69559561 synonymous silent
R0219:Guf1 UTSW 5 69559586 missense probably damaging 1.00
R0269:Guf1 UTSW 5 69559599 missense probably damaging 0.99
R0624:Guf1 UTSW 5 69558580 missense probably damaging 1.00
R0690:Guf1 UTSW 5 69566352 intron probably null
R0906:Guf1 UTSW 5 69566386 missense probably damaging 0.99
R1082:Guf1 UTSW 5 69567212 missense possibly damaging 0.95
R1386:Guf1 UTSW 5 69563162 missense probably benign
R1506:Guf1 UTSW 5 69567166 missense possibly damaging 0.85
R1859:Guf1 UTSW 5 69568460 nonsense probably null
R1982:Guf1 UTSW 5 69567226 nonsense probably null
R3782:Guf1 UTSW 5 69567152 missense probably benign 0.01
R3847:Guf1 UTSW 5 69561157 missense probably damaging 0.99
R4172:Guf1 UTSW 5 69558229 missense possibly damaging 0.88
R4513:Guf1 UTSW 5 69561662 missense probably benign 0.00
R4592:Guf1 UTSW 5 69566443 missense possibly damaging 0.55
R4811:Guf1 UTSW 5 69564509 splice site probably null
R5435:Guf1 UTSW 5 69563169 missense probably benign 0.01
R6181:Guf1 UTSW 5 69561716 missense probably damaging 1.00
R6246:Guf1 UTSW 5 69558555 missense probably damaging 1.00
R6411:Guf1 UTSW 5 69560511 missense possibly damaging 0.87
R6701:Guf1 UTSW 5 69558253 missense probably damaging 1.00
R6724:Guf1 UTSW 5 69566393 missense probably damaging 0.99
R7634:Guf1 UTSW 5 69564544 missense probably damaging 0.97
X0018:Guf1 UTSW 5 69566366 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTGGTATACTCTGTTCTGCTTAC -3'
(R):5'- TTTCAGTTAGGTCAATCTCCTGAG -3'

Sequencing Primer
(F):5'- CCTTTTGGCTAAGATCAAGTGTAATC -3'
(R):5'- AGTATGCAGCACCTTCATGG -3'
Posted On2016-12-15