Mutagenetix > Incidental Mutations

Incidental Mutation 'R5792:Slco1a5'

447020

Institutional Source

Beutler Lab

Gene Symbol

Slco1a5

Ensembl Gene

ENSMUSG00000063975

Gene Name

solute carrier organic anion transporter family, member 1a5

Synonyms

Oatp3, Slc21a7

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R5792 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

142234227-142322981 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 142242113 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 500 (C500Y)

Ref Sequence

ENSEMBL: ENSMUSP00000137607 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081380] [ENSMUST00000111825] [ENSMUST00000153268]

Predicted Effect

probably damaging
Transcript: ENSMUST00000081380
AA Change: C500Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080116
Gene: ENSMUSG00000063975
AA Change: C500Y

Domain	Start	End	E-Value	Type
Pfam:MFS_1	22	420	4.3e-30	PFAM
KAZAL	438	486	2.18e0	SMART
transmembrane domain	600	622	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111825
AA Change: C500Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000137607
Gene: ENSMUSG00000063975
AA Change: C500Y

Domain	Start	End	E-Value	Type
Pfam:MFS_1	22	420	5.8e-30	PFAM
KAZAL	438	486	2.18e0	SMART
transmembrane domain	600	622	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153268

SMART Domains

Protein: ENSMUSP00000124829
Gene: ENSMUSG00000063975

Domain	Start	End	E-Value	Type
Pfam:OATP	19	74	3.4e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157614

Meta Mutation Damage Score

0.8675

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

95% (56/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium-independent transporter which mediates cellular uptake of organic ions in the liver. Its substrates include bile acids, bromosulphophthalein, and some steroidal compounds. The protein is a member of the SLC21A family of solute carriers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased percentage of CD8 ells and increased percentage of B cells in the peripheral blood. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,521	I296F	possibly damaging	Het
Adamts19	C	T	18: 58,837,512	T56M	possibly damaging	Het
Armc4	T	C	18: 7,217,965	N583S	probably benign	Het
Axdnd1	T	G	1: 156,341,889	E802D	probably damaging	Het
Birc6	T	C	17: 74,631,053	V2630A	probably benign	Het
Capn5	A	T	7: 98,131,195	F323I	probably benign	Het
Cdc25b	A	G	2: 131,191,759	E206G	probably damaging	Het
Cmah	T	G	13: 24,456,915	N382K	probably benign	Het
Col11a1	A	T	3: 114,131,593	D25V	probably damaging	Het
Cyp2d41-ps	G	T	15: 82,779,220		noncoding transcript	Het
Cyp3a59	A	G	5: 146,099,851	K288E	possibly damaging	Het
Cyr61	T	C	3: 145,648,658	D166G	probably benign	Het
Dclre1a	A	C	19: 56,529,590	I1019S	probably damaging	Het
Fat2	G	T	11: 55,262,325	A3687D	possibly damaging	Het
Flg2	T	A	3: 93,203,497	V944E	unknown	Het
Galntl5	T	C	5: 25,198,463	V177A	possibly damaging	Het
Gm12695	T	C	4: 96,728,283	T438A	probably benign	Het
Gm14295	A	T	2: 176,811,014	N766Y	probably benign	Het
Gm15433	T	A	1: 84,964,112		noncoding transcript	Het
Gm2431	C	T	7: 142,258,332	G8E	unknown	Het
Gm5435	T	A	12: 82,495,426		noncoding transcript	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Grip1	T	C	10: 119,985,480	I350T	probably benign	Het
Guf1	T	A	5: 69,560,486	F196I	probably damaging	Het
Kcng4	G	T	8: 119,626,279	D297E	probably damaging	Het
Khdrbs2	G	A	1: 32,472,692	R246Q	probably damaging	Het
Layn	T	C	9: 51,068,161	E148G	probably damaging	Het
Lrig3	T	A	10: 126,009,919	V739E	probably damaging	Het
Lyg1	A	G	1: 37,947,267	W129R	probably benign	Het
Nup210l	C	T	3: 90,199,857	T1567I	probably damaging	Het
Nus1	T	A	10: 52,429,256	L12*	probably null	Het
Olfr2	A	T	7: 107,001,443	V139D	possibly damaging	Het
Olfr354	A	G	2: 36,907,101	I52V	probably benign	Het
Otop1	A	G	5: 38,297,916	N218S	probably benign	Het
Pcif1	T	A	2: 164,885,379	N90K	probably damaging	Het
Phf2	T	C	13: 48,820,042		probably null	Het
Piezo2	T	A	18: 63,146,856	I215F	probably damaging	Het
Pitpnm2	G	T	5: 124,130,321	C553*	probably null	Het
Prdm1	A	G	10: 44,450,228	V115A	probably damaging	Het
Prkdc	A	G	16: 15,816,752	D3587G	probably damaging	Het
Sez6l	A	T	5: 112,422,024	Y883*	probably null	Het
Sh3rf2	A	C	18: 42,111,138	H223P	probably damaging	Het
Slf1	T	A	13: 77,066,737	H610L	probably benign	Het
Syn3	T	C	10: 86,294,628	*244W	probably null	Het
Sytl2	A	T	7: 90,375,689	D295V	probably damaging	Het
Tnfrsf1a	T	A	6: 125,358,077	C44S	probably damaging	Het
Ttc6	T	G	12: 57,673,204	L854V	possibly damaging	Het
Ttn	T	C	2: 76,766,258	I18358V	probably benign	Het
Vmn2r108	A	G	17: 20,463,136	V602A	probably damaging	Het
Zap70	A	G	1: 36,779,009		probably benign	Het
Zfhx2	T	C	14: 55,066,846	E1227G	possibly damaging	Het
Znhit3	G	A	11: 84,916,084		probably null	Het
Zpbp2	A	G	11: 98,551,410		probably benign	Het

Other mutations in Slco1a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01304:Slco1a5	APN	6	142242150	missense	probably benign	0.00
IGL01432:Slco1a5	APN	6	142236286	missense	possibly damaging	0.59
IGL01590:Slco1a5	APN	6	142250319	missense	probably benign	0.01
IGL01824:Slco1a5	APN	6	142253037	missense	probably benign	0.01
IGL01915:Slco1a5	APN	6	142243873	missense	probably benign	0.00
IGL01945:Slco1a5	APN	6	142243989	critical splice acceptor site	probably null
IGL02078:Slco1a5	APN	6	142254446	missense	probably benign	0.30
IGL02178:Slco1a5	APN	6	142262688	nonsense	probably null
IGL02366:Slco1a5	APN	6	142250215	missense	possibly damaging	0.57
IGL02395:Slco1a5	APN	6	142275487	missense	probably damaging	0.99
IGL02621:Slco1a5	APN	6	142242015	missense	probably benign	0.10
IGL02752:Slco1a5	APN	6	142262712	missense	probably benign	0.07
IGL02940:Slco1a5	APN	6	142242005	missense	probably damaging	1.00
IGL03065:Slco1a5	APN	6	142248843	splice site	probably benign
IGL03377:Slco1a5	APN	6	142234766	missense	probably benign	0.01
R0017:Slco1a5	UTSW	6	142236335	splice site	probably benign
R0017:Slco1a5	UTSW	6	142236335	splice site	probably benign
R0230:Slco1a5	UTSW	6	142236328	splice site	probably benign
R0690:Slco1a5	UTSW	6	142268278	missense	probably benign	0.24
R1217:Slco1a5	UTSW	6	142254374	missense	probably damaging	0.98
R1900:Slco1a5	UTSW	6	142242063	missense	probably benign	0.44
R2084:Slco1a5	UTSW	6	142234711	missense	probably benign	0.32
R2393:Slco1a5	UTSW	6	142248775	missense	possibly damaging	0.85
R2414:Slco1a5	UTSW	6	142236250	missense	probably damaging	1.00
R2760:Slco1a5	UTSW	6	142250271	missense	probably benign	0.00
R3420:Slco1a5	UTSW	6	142268238	missense	possibly damaging	0.61
R3421:Slco1a5	UTSW	6	142268238	missense	possibly damaging	0.61
R3827:Slco1a5	UTSW	6	142253249	missense	probably damaging	0.97
R3963:Slco1a5	UTSW	6	142248644	critical splice donor site	probably null
R3977:Slco1a5	UTSW	6	142258972	splice site	probably benign
R4074:Slco1a5	UTSW	6	142268224	missense	possibly damaging	0.88
R4075:Slco1a5	UTSW	6	142268224	missense	possibly damaging	0.88
R4076:Slco1a5	UTSW	6	142268224	missense	possibly damaging	0.88
R4782:Slco1a5	UTSW	6	142248807	missense	possibly damaging	0.82
R4799:Slco1a5	UTSW	6	142248807	missense	possibly damaging	0.82
R4831:Slco1a5	UTSW	6	142234705	missense	probably benign
R5038:Slco1a5	UTSW	6	142262637	missense	probably benign	0.01
R5038:Slco1a5	UTSW	6	142266364	missense	probably damaging	1.00
R5063:Slco1a5	UTSW	6	142259065	missense	probably damaging	1.00
R5273:Slco1a5	UTSW	6	142242098	missense	probably benign	0.00
R5436:Slco1a5	UTSW	6	142254392	missense	probably damaging	1.00
R5579:Slco1a5	UTSW	6	142242125	missense	possibly damaging	0.93
R5602:Slco1a5	UTSW	6	142275529	start gained	probably benign
R5643:Slco1a5	UTSW	6	142237594	splice site	probably null
R5644:Slco1a5	UTSW	6	142237594	splice site	probably null
R5686:Slco1a5	UTSW	6	142236307	missense	probably damaging	1.00
R5699:Slco1a5	UTSW	6	142248816	missense	probably damaging	0.96
R5938:Slco1a5	UTSW	6	142248717	missense	probably damaging	0.97
R5997:Slco1a5	UTSW	6	142253113	missense	probably benign	0.19
R6146:Slco1a5	UTSW	6	142234808	missense	probably benign
R6377:Slco1a5	UTSW	6	142242180	splice site	probably null
R6466:Slco1a5	UTSW	6	142237534	missense	probably benign	0.01
R6523:Slco1a5	UTSW	6	142266395	missense	probably damaging	1.00
R7092:Slco1a5	UTSW	6	142248675	missense	probably benign
R7207:Slco1a5	UTSW	6	142248749	nonsense	probably null
R7356:Slco1a5	UTSW	6	142234732	missense	probably benign	0.01
R7430:Slco1a5	UTSW	6	142248712	missense	probably benign	0.00
R7445:Slco1a5	UTSW	6	142259008	missense	possibly damaging	0.93
R7499:Slco1a5	UTSW	6	142262531	splice site	probably null
R7579:Slco1a5	UTSW	6	142275481	missense	probably benign	0.00
R8117:Slco1a5	UTSW	6	142262692	missense	probably damaging	1.00
R8209:Slco1a5	UTSW	6	142262682	missense	probably damaging	1.00
R8217:Slco1a5	UTSW	6	142275476	missense	probably benign	0.13
R8358:Slco1a5	UTSW	6	142262685	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- CATCACACACTTGCATATGAACATG -3'
(R):5'- TGTGCTCAAACTCGGGTTC -3'

Sequencing Primer
(F):5'- CATATGAACATGCTACAAAGAAGGAC -3'
(R):5'- GTGCTCAAACTCGGGTTCTAATTC -3'

Posted On

2016-12-15