Incidental Mutation 'R5792:Slco1a5'
ID447020
Institutional Source Beutler Lab
Gene Symbol Slco1a5
Ensembl Gene ENSMUSG00000063975
Gene Namesolute carrier organic anion transporter family, member 1a5
SynonymsOatp3, Slc21a7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5792 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location142234227-142322981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 142242113 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 500 (C500Y)
Ref Sequence ENSEMBL: ENSMUSP00000137607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081380] [ENSMUST00000111825] [ENSMUST00000153268]
Predicted Effect probably damaging
Transcript: ENSMUST00000081380
AA Change: C500Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080116
Gene: ENSMUSG00000063975
AA Change: C500Y

DomainStartEndE-ValueType
Pfam:MFS_1 22 420 4.3e-30 PFAM
KAZAL 438 486 2.18e0 SMART
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111825
AA Change: C500Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137607
Gene: ENSMUSG00000063975
AA Change: C500Y

DomainStartEndE-ValueType
Pfam:MFS_1 22 420 5.8e-30 PFAM
KAZAL 438 486 2.18e0 SMART
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153268
SMART Domains Protein: ENSMUSP00000124829
Gene: ENSMUSG00000063975

DomainStartEndE-ValueType
Pfam:OATP 19 74 3.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157614
Meta Mutation Damage Score 0.8675 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (56/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium-independent transporter which mediates cellular uptake of organic ions in the liver. Its substrates include bile acids, bromosulphophthalein, and some steroidal compounds. The protein is a member of the SLC21A family of solute carriers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased percentage of CD8 ells and increased percentage of B cells in the peripheral blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,521 I296F possibly damaging Het
Adamts19 C T 18: 58,837,512 T56M possibly damaging Het
Armc4 T C 18: 7,217,965 N583S probably benign Het
Axdnd1 T G 1: 156,341,889 E802D probably damaging Het
Birc6 T C 17: 74,631,053 V2630A probably benign Het
Capn5 A T 7: 98,131,195 F323I probably benign Het
Cdc25b A G 2: 131,191,759 E206G probably damaging Het
Cmah T G 13: 24,456,915 N382K probably benign Het
Col11a1 A T 3: 114,131,593 D25V probably damaging Het
Cyp2d41-ps G T 15: 82,779,220 noncoding transcript Het
Cyp3a59 A G 5: 146,099,851 K288E possibly damaging Het
Cyr61 T C 3: 145,648,658 D166G probably benign Het
Dclre1a A C 19: 56,529,590 I1019S probably damaging Het
Fat2 G T 11: 55,262,325 A3687D possibly damaging Het
Flg2 T A 3: 93,203,497 V944E unknown Het
Galntl5 T C 5: 25,198,463 V177A possibly damaging Het
Gm12695 T C 4: 96,728,283 T438A probably benign Het
Gm14295 A T 2: 176,811,014 N766Y probably benign Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm2431 C T 7: 142,258,332 G8E unknown Het
Gm5435 T A 12: 82,495,426 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grip1 T C 10: 119,985,480 I350T probably benign Het
Guf1 T A 5: 69,560,486 F196I probably damaging Het
Kcng4 G T 8: 119,626,279 D297E probably damaging Het
Khdrbs2 G A 1: 32,472,692 R246Q probably damaging Het
Layn T C 9: 51,068,161 E148G probably damaging Het
Lrig3 T A 10: 126,009,919 V739E probably damaging Het
Lyg1 A G 1: 37,947,267 W129R probably benign Het
Nup210l C T 3: 90,199,857 T1567I probably damaging Het
Nus1 T A 10: 52,429,256 L12* probably null Het
Olfr2 A T 7: 107,001,443 V139D possibly damaging Het
Olfr354 A G 2: 36,907,101 I52V probably benign Het
Otop1 A G 5: 38,297,916 N218S probably benign Het
Pcif1 T A 2: 164,885,379 N90K probably damaging Het
Phf2 T C 13: 48,820,042 probably null Het
Piezo2 T A 18: 63,146,856 I215F probably damaging Het
Pitpnm2 G T 5: 124,130,321 C553* probably null Het
Prdm1 A G 10: 44,450,228 V115A probably damaging Het
Prkdc A G 16: 15,816,752 D3587G probably damaging Het
Sez6l A T 5: 112,422,024 Y883* probably null Het
Sh3rf2 A C 18: 42,111,138 H223P probably damaging Het
Slf1 T A 13: 77,066,737 H610L probably benign Het
Syn3 T C 10: 86,294,628 *244W probably null Het
Sytl2 A T 7: 90,375,689 D295V probably damaging Het
Tnfrsf1a T A 6: 125,358,077 C44S probably damaging Het
Ttc6 T G 12: 57,673,204 L854V possibly damaging Het
Ttn T C 2: 76,766,258 I18358V probably benign Het
Vmn2r108 A G 17: 20,463,136 V602A probably damaging Het
Zap70 A G 1: 36,779,009 probably benign Het
Zfhx2 T C 14: 55,066,846 E1227G possibly damaging Het
Znhit3 G A 11: 84,916,084 probably null Het
Zpbp2 A G 11: 98,551,410 probably benign Het
Other mutations in Slco1a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Slco1a5 APN 6 142242150 missense probably benign 0.00
IGL01432:Slco1a5 APN 6 142236286 missense possibly damaging 0.59
IGL01590:Slco1a5 APN 6 142250319 missense probably benign 0.01
IGL01824:Slco1a5 APN 6 142253037 missense probably benign 0.01
IGL01915:Slco1a5 APN 6 142243873 missense probably benign 0.00
IGL01945:Slco1a5 APN 6 142243989 critical splice acceptor site probably null
IGL02078:Slco1a5 APN 6 142254446 missense probably benign 0.30
IGL02178:Slco1a5 APN 6 142262688 nonsense probably null
IGL02366:Slco1a5 APN 6 142250215 missense possibly damaging 0.57
IGL02395:Slco1a5 APN 6 142275487 missense probably damaging 0.99
IGL02621:Slco1a5 APN 6 142242015 missense probably benign 0.10
IGL02752:Slco1a5 APN 6 142262712 missense probably benign 0.07
IGL02940:Slco1a5 APN 6 142242005 missense probably damaging 1.00
IGL03065:Slco1a5 APN 6 142248843 splice site probably benign
IGL03377:Slco1a5 APN 6 142234766 missense probably benign 0.01
R0017:Slco1a5 UTSW 6 142236335 splice site probably benign
R0017:Slco1a5 UTSW 6 142236335 splice site probably benign
R0230:Slco1a5 UTSW 6 142236328 splice site probably benign
R0690:Slco1a5 UTSW 6 142268278 missense probably benign 0.24
R1217:Slco1a5 UTSW 6 142254374 missense probably damaging 0.98
R1900:Slco1a5 UTSW 6 142242063 missense probably benign 0.44
R2084:Slco1a5 UTSW 6 142234711 missense probably benign 0.32
R2393:Slco1a5 UTSW 6 142248775 missense possibly damaging 0.85
R2414:Slco1a5 UTSW 6 142236250 missense probably damaging 1.00
R2760:Slco1a5 UTSW 6 142250271 missense probably benign 0.00
R3420:Slco1a5 UTSW 6 142268238 missense possibly damaging 0.61
R3421:Slco1a5 UTSW 6 142268238 missense possibly damaging 0.61
R3827:Slco1a5 UTSW 6 142253249 missense probably damaging 0.97
R3963:Slco1a5 UTSW 6 142248644 critical splice donor site probably null
R3977:Slco1a5 UTSW 6 142258972 splice site probably benign
R4074:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4075:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4076:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4782:Slco1a5 UTSW 6 142248807 missense possibly damaging 0.82
R4799:Slco1a5 UTSW 6 142248807 missense possibly damaging 0.82
R4831:Slco1a5 UTSW 6 142234705 missense probably benign
R5038:Slco1a5 UTSW 6 142262637 missense probably benign 0.01
R5038:Slco1a5 UTSW 6 142266364 missense probably damaging 1.00
R5063:Slco1a5 UTSW 6 142259065 missense probably damaging 1.00
R5273:Slco1a5 UTSW 6 142242098 missense probably benign 0.00
R5436:Slco1a5 UTSW 6 142254392 missense probably damaging 1.00
R5579:Slco1a5 UTSW 6 142242125 missense possibly damaging 0.93
R5602:Slco1a5 UTSW 6 142275529 start gained probably benign
R5643:Slco1a5 UTSW 6 142237594 splice site probably null
R5644:Slco1a5 UTSW 6 142237594 splice site probably null
R5686:Slco1a5 UTSW 6 142236307 missense probably damaging 1.00
R5699:Slco1a5 UTSW 6 142248816 missense probably damaging 0.96
R5938:Slco1a5 UTSW 6 142248717 missense probably damaging 0.97
R5997:Slco1a5 UTSW 6 142253113 missense probably benign 0.19
R6146:Slco1a5 UTSW 6 142234808 missense probably benign
R6377:Slco1a5 UTSW 6 142242180 splice site probably null
R6466:Slco1a5 UTSW 6 142237534 missense probably benign 0.01
R6523:Slco1a5 UTSW 6 142266395 missense probably damaging 1.00
R7092:Slco1a5 UTSW 6 142248675 missense probably benign
R7207:Slco1a5 UTSW 6 142248749 nonsense probably null
R7356:Slco1a5 UTSW 6 142234732 missense probably benign 0.01
R7430:Slco1a5 UTSW 6 142248712 missense probably benign 0.00
R7445:Slco1a5 UTSW 6 142259008 missense possibly damaging 0.93
R7499:Slco1a5 UTSW 6 142262531 splice site probably null
R7579:Slco1a5 UTSW 6 142275481 missense probably benign 0.00
R8117:Slco1a5 UTSW 6 142262692 missense probably damaging 1.00
R8209:Slco1a5 UTSW 6 142262682 missense probably damaging 1.00
R8217:Slco1a5 UTSW 6 142275476 missense probably benign 0.13
R8358:Slco1a5 UTSW 6 142262685 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CATCACACACTTGCATATGAACATG -3'
(R):5'- TGTGCTCAAACTCGGGTTC -3'

Sequencing Primer
(F):5'- CATATGAACATGCTACAAAGAAGGAC -3'
(R):5'- GTGCTCAAACTCGGGTTCTAATTC -3'
Posted On2016-12-15