Incidental Mutation 'R5792:4930433I11Rik'
ID447022
Institutional Source Beutler Lab
Gene Symbol 4930433I11Rik
Ensembl Gene ENSMUSG00000091692
Gene NameRIKEN cDNA 4930433I11 gene
SynonymsLOC243944
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5792 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location40987543-40995435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40993521 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 296 (I296F)
Ref Sequence ENSEMBL: ENSMUSP00000146117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171664] [ENSMUST00000206529]
Predicted Effect possibly damaging
Transcript: ENSMUST00000171664
AA Change: I205F

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131120
Gene: ENSMUSG00000091692
AA Change: I205F

DomainStartEndE-ValueType
Pfam:DUF4629 208 354 2.2e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206360
Predicted Effect possibly damaging
Transcript: ENSMUST00000206529
AA Change: I296F

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (56/59)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 C T 18: 58,837,512 T56M possibly damaging Het
Armc4 T C 18: 7,217,965 N583S probably benign Het
Axdnd1 T G 1: 156,341,889 E802D probably damaging Het
Birc6 T C 17: 74,631,053 V2630A probably benign Het
Capn5 A T 7: 98,131,195 F323I probably benign Het
Cdc25b A G 2: 131,191,759 E206G probably damaging Het
Cmah T G 13: 24,456,915 N382K probably benign Het
Col11a1 A T 3: 114,131,593 D25V probably damaging Het
Cyp2d41-ps G T 15: 82,779,220 noncoding transcript Het
Cyp3a59 A G 5: 146,099,851 K288E possibly damaging Het
Cyr61 T C 3: 145,648,658 D166G probably benign Het
Dclre1a A C 19: 56,529,590 I1019S probably damaging Het
Fat2 G T 11: 55,262,325 A3687D possibly damaging Het
Flg2 T A 3: 93,203,497 V944E unknown Het
Galntl5 T C 5: 25,198,463 V177A possibly damaging Het
Gm12695 T C 4: 96,728,283 T438A probably benign Het
Gm14295 A T 2: 176,811,014 N766Y probably benign Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm2431 C T 7: 142,258,332 G8E unknown Het
Gm5435 T A 12: 82,495,426 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grip1 T C 10: 119,985,480 I350T probably benign Het
Guf1 T A 5: 69,560,486 F196I probably damaging Het
Kcng4 G T 8: 119,626,279 D297E probably damaging Het
Khdrbs2 G A 1: 32,472,692 R246Q probably damaging Het
Layn T C 9: 51,068,161 E148G probably damaging Het
Lrig3 T A 10: 126,009,919 V739E probably damaging Het
Lyg1 A G 1: 37,947,267 W129R probably benign Het
Nup210l C T 3: 90,199,857 T1567I probably damaging Het
Nus1 T A 10: 52,429,256 L12* probably null Het
Olfr2 A T 7: 107,001,443 V139D possibly damaging Het
Olfr354 A G 2: 36,907,101 I52V probably benign Het
Otop1 A G 5: 38,297,916 N218S probably benign Het
Pcif1 T A 2: 164,885,379 N90K probably damaging Het
Phf2 T C 13: 48,820,042 probably null Het
Piezo2 T A 18: 63,146,856 I215F probably damaging Het
Pitpnm2 G T 5: 124,130,321 C553* probably null Het
Prdm1 A G 10: 44,450,228 V115A probably damaging Het
Prkdc A G 16: 15,816,752 D3587G probably damaging Het
Sez6l A T 5: 112,422,024 Y883* probably null Het
Sh3rf2 A C 18: 42,111,138 H223P probably damaging Het
Slco1a5 C T 6: 142,242,113 C500Y probably damaging Het
Slf1 T A 13: 77,066,737 H610L probably benign Het
Syn3 T C 10: 86,294,628 *244W probably null Het
Sytl2 A T 7: 90,375,689 D295V probably damaging Het
Tnfrsf1a T A 6: 125,358,077 C44S probably damaging Het
Ttc6 T G 12: 57,673,204 L854V possibly damaging Het
Ttn T C 2: 76,766,258 I18358V probably benign Het
Vmn2r108 A G 17: 20,463,136 V602A probably damaging Het
Zap70 A G 1: 36,779,009 probably benign Het
Zfhx2 T C 14: 55,066,846 E1227G possibly damaging Het
Znhit3 G A 11: 84,916,084 probably null Het
Zpbp2 A G 11: 98,551,410 probably benign Het
Other mutations in 4930433I11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02380:4930433I11Rik APN 7 40994544 missense possibly damaging 0.50
BB002:4930433I11Rik UTSW 7 40994082 nonsense probably null
BB012:4930433I11Rik UTSW 7 40994082 nonsense probably null
FR4304:4930433I11Rik UTSW 7 40993056 small deletion probably benign
FR4340:4930433I11Rik UTSW 7 40993055 small deletion probably benign
FR4342:4930433I11Rik UTSW 7 40993055 small deletion probably benign
FR4548:4930433I11Rik UTSW 7 40993056 small deletion probably benign
R0498:4930433I11Rik UTSW 7 40993294 missense probably benign 0.11
R0610:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0704:4930433I11Rik UTSW 7 40993957 missense probably damaging 1.00
R0723:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0826:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0850:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0862:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0863:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0960:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0961:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0964:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1099:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1101:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1167:4930433I11Rik UTSW 7 40993579 missense probably damaging 1.00
R1401:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1429:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1462:4930433I11Rik UTSW 7 40992946 nonsense probably null
R1462:4930433I11Rik UTSW 7 40992946 nonsense probably null
R1816:4930433I11Rik UTSW 7 40994798 nonsense probably null
R1852:4930433I11Rik UTSW 7 40993613 missense probably benign 0.29
R3814:4930433I11Rik UTSW 7 40992919 missense probably damaging 0.99
R4124:4930433I11Rik UTSW 7 40993921 missense probably damaging 1.00
R4823:4930433I11Rik UTSW 7 40993362 missense probably benign 0.00
R5092:4930433I11Rik UTSW 7 40987667 start gained probably benign
R6160:4930433I11Rik UTSW 7 40993526 missense possibly damaging 0.91
R6300:4930433I11Rik UTSW 7 40993461 missense possibly damaging 0.91
R6349:4930433I11Rik UTSW 7 40994772 missense possibly damaging 0.89
R6755:4930433I11Rik UTSW 7 40994310 missense probably damaging 1.00
R6995:4930433I11Rik UTSW 7 40994725 missense probably benign 0.00
R7156:4930433I11Rik UTSW 7 40993858 missense possibly damaging 0.54
R7232:4930433I11Rik UTSW 7 40993179 missense probably damaging 1.00
R7318:4930433I11Rik UTSW 7 40993687 missense probably benign 0.04
R7395:4930433I11Rik UTSW 7 40989678 missense probably damaging 0.97
R7925:4930433I11Rik UTSW 7 40994082 nonsense probably null
RF003:4930433I11Rik UTSW 7 40993055 small deletion probably benign
RF004:4930433I11Rik UTSW 7 40993055 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCTGACAATGACAGCTTGGG -3'
(R):5'- CTCCAAGTCCTTAGCCATGTTG -3'

Sequencing Primer
(F):5'- ACTGGACAGTTTGAAGGTGTCCAC -3'
(R):5'- AGCCATGTTGTCAATAGCCCTG -3'
Posted On2016-12-15