Incidental Mutation 'R5792:Sytl2'
ID447023
Institutional Source Beutler Lab
Gene Symbol Sytl2
Ensembl Gene ENSMUSG00000030616
Gene Namesynaptotagmin-like 2
SynonymsSlp2-a, Slp2-b, Slp2-d, Slp2-c, Slp2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R5792 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location90302252-90410719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90375689 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 295 (D295V)
Ref Sequence ENSEMBL: ENSMUSP00000147191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107210] [ENSMUST00000107211] [ENSMUST00000190731] [ENSMUST00000190837] [ENSMUST00000207578] [ENSMUST00000208720]
Predicted Effect probably benign
Transcript: ENSMUST00000107210
AA Change: D295V

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102828
Gene: ENSMUSG00000030616
AA Change: D295V

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.5e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
C2 620 725 4.59e-15 SMART
C2 769 872 6.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107211
AA Change: D295V

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102829
Gene: ENSMUSG00000030616
AA Change: D295V

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.6e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
low complexity region 592 620 N/A INTRINSIC
C2 644 749 4.59e-15 SMART
C2 793 896 6.44e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190731
AA Change: D295V

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139865
Gene: ENSMUSG00000030616
AA Change: D295V

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.8e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
low complexity region 608 636 N/A INTRINSIC
C2 660 765 4.59e-15 SMART
C2 809 912 6.44e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190837
AA Change: D268V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139450
Gene: ENSMUSG00000030616
AA Change: D268V

DomainStartEndE-ValueType
Pfam:FYVE_2 5 59 5.6e-9 PFAM
low complexity region 82 93 N/A INTRINSIC
low complexity region 165 178 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 581 609 N/A INTRINSIC
C2 633 738 4.59e-15 SMART
C2 782 885 6.44e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207455
Predicted Effect probably benign
Transcript: ENSMUST00000207578
Predicted Effect probably damaging
Transcript: ENSMUST00000208720
AA Change: D295V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (56/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null allele display abnormal gastric surface mucus cell morphology and reduced basal mucin secretion from gastric cells [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,521 I296F possibly damaging Het
Adamts19 C T 18: 58,837,512 T56M possibly damaging Het
Armc4 T C 18: 7,217,965 N583S probably benign Het
Axdnd1 T G 1: 156,341,889 E802D probably damaging Het
Birc6 T C 17: 74,631,053 V2630A probably benign Het
Capn5 A T 7: 98,131,195 F323I probably benign Het
Cdc25b A G 2: 131,191,759 E206G probably damaging Het
Cmah T G 13: 24,456,915 N382K probably benign Het
Col11a1 A T 3: 114,131,593 D25V probably damaging Het
Cyp2d41-ps G T 15: 82,779,220 noncoding transcript Het
Cyp3a59 A G 5: 146,099,851 K288E possibly damaging Het
Cyr61 T C 3: 145,648,658 D166G probably benign Het
Dclre1a A C 19: 56,529,590 I1019S probably damaging Het
Fat2 G T 11: 55,262,325 A3687D possibly damaging Het
Flg2 T A 3: 93,203,497 V944E unknown Het
Galntl5 T C 5: 25,198,463 V177A possibly damaging Het
Gm12695 T C 4: 96,728,283 T438A probably benign Het
Gm14295 A T 2: 176,811,014 N766Y probably benign Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm2431 C T 7: 142,258,332 G8E unknown Het
Gm5435 T A 12: 82,495,426 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grip1 T C 10: 119,985,480 I350T probably benign Het
Guf1 T A 5: 69,560,486 F196I probably damaging Het
Kcng4 G T 8: 119,626,279 D297E probably damaging Het
Khdrbs2 G A 1: 32,472,692 R246Q probably damaging Het
Layn T C 9: 51,068,161 E148G probably damaging Het
Lrig3 T A 10: 126,009,919 V739E probably damaging Het
Lyg1 A G 1: 37,947,267 W129R probably benign Het
Nup210l C T 3: 90,199,857 T1567I probably damaging Het
Nus1 T A 10: 52,429,256 L12* probably null Het
Olfr2 A T 7: 107,001,443 V139D possibly damaging Het
Olfr354 A G 2: 36,907,101 I52V probably benign Het
Otop1 A G 5: 38,297,916 N218S probably benign Het
Pcif1 T A 2: 164,885,379 N90K probably damaging Het
Phf2 T C 13: 48,820,042 probably null Het
Piezo2 T A 18: 63,146,856 I215F probably damaging Het
Pitpnm2 G T 5: 124,130,321 C553* probably null Het
Prdm1 A G 10: 44,450,228 V115A probably damaging Het
Prkdc A G 16: 15,816,752 D3587G probably damaging Het
Sez6l A T 5: 112,422,024 Y883* probably null Het
Sh3rf2 A C 18: 42,111,138 H223P probably damaging Het
Slco1a5 C T 6: 142,242,113 C500Y probably damaging Het
Slf1 T A 13: 77,066,737 H610L probably benign Het
Syn3 T C 10: 86,294,628 *244W probably null Het
Tnfrsf1a T A 6: 125,358,077 C44S probably damaging Het
Ttc6 T G 12: 57,673,204 L854V possibly damaging Het
Ttn T C 2: 76,766,258 I18358V probably benign Het
Vmn2r108 A G 17: 20,463,136 V602A probably damaging Het
Zap70 A G 1: 36,779,009 probably benign Het
Zfhx2 T C 14: 55,066,846 E1227G possibly damaging Het
Znhit3 G A 11: 84,916,084 probably null Het
Zpbp2 A G 11: 98,551,410 probably benign Het
Other mutations in Sytl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Sytl2 APN 7 90372905 missense probably benign 0.25
IGL00657:Sytl2 APN 7 90401410 missense probably benign 0.40
IGL00788:Sytl2 APN 7 90382698 intron probably benign
IGL00834:Sytl2 APN 7 90382636 intron probably benign
IGL01833:Sytl2 APN 7 90396537 missense probably damaging 0.99
IGL01866:Sytl2 APN 7 90381839 intron probably benign
IGL02215:Sytl2 APN 7 90381214 intron probably benign
IGL02934:Sytl2 APN 7 90375992 missense probably benign 0.00
IGL03095:Sytl2 APN 7 90392434 missense probably damaging 1.00
finder UTSW 7 90375652 missense probably damaging 1.00
keeper UTSW 7 90358224 nonsense probably null
R0126:Sytl2 UTSW 7 90396589 missense probably damaging 1.00
R0269:Sytl2 UTSW 7 90403020 splice site probably benign
R0270:Sytl2 UTSW 7 90403020 splice site probably benign
R0271:Sytl2 UTSW 7 90403020 splice site probably benign
R0288:Sytl2 UTSW 7 90403020 splice site probably benign
R0528:Sytl2 UTSW 7 90403020 splice site probably benign
R0601:Sytl2 UTSW 7 90395166 missense probably damaging 1.00
R0610:Sytl2 UTSW 7 90380853 intron probably benign
R1634:Sytl2 UTSW 7 90395182 missense probably damaging 1.00
R1777:Sytl2 UTSW 7 90403052 missense probably benign 0.25
R2040:Sytl2 UTSW 7 90381861 intron probably benign
R3788:Sytl2 UTSW 7 90376081 missense probably benign 0.00
R3843:Sytl2 UTSW 7 90360159 missense possibly damaging 0.77
R3952:Sytl2 UTSW 7 90381492 intron probably benign
R4082:Sytl2 UTSW 7 90408427 missense possibly damaging 0.88
R4600:Sytl2 UTSW 7 90375769 missense probably benign 0.11
R4651:Sytl2 UTSW 7 90375425 missense probably damaging 1.00
R4724:Sytl2 UTSW 7 90348792 start codon destroyed probably null 1.00
R4730:Sytl2 UTSW 7 90381249 intron probably benign
R4870:Sytl2 UTSW 7 90388898 missense probably damaging 1.00
R4959:Sytl2 UTSW 7 90376037 missense probably damaging 0.97
R4995:Sytl2 UTSW 7 90382257 intron probably benign
R5009:Sytl2 UTSW 7 90381315 intron probably benign
R5096:Sytl2 UTSW 7 90376082 missense possibly damaging 0.49
R5191:Sytl2 UTSW 7 90375652 missense probably damaging 1.00
R5305:Sytl2 UTSW 7 90381863 intron probably benign
R5538:Sytl2 UTSW 7 90388906 missense probably benign 0.03
R6378:Sytl2 UTSW 7 90358224 nonsense probably null
R6982:Sytl2 UTSW 7 90396564 missense probably damaging 0.96
R7456:Sytl2 UTSW 7 90348847 missense probably damaging 1.00
R7600:Sytl2 UTSW 7 90376144 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGAGCCTGAAAATGCGTC -3'
(R):5'- AGTAAATTCTCCCACTTCCTGG -3'

Sequencing Primer
(F):5'- GAGCCTGAAAATGCGTCTCATAC -3'
(R):5'- TGGCCAAGGACGGGTCTAG -3'
Posted On2016-12-15