Incidental Mutation 'R5792:Olfr2'
ID447025
Institutional Source Beutler Lab
Gene Symbol Olfr2
Ensembl Gene ENSMUSG00000070417
Gene Nameolfactory receptor 2
SynonymsMOR103-15, I7, I54, Olfr41, GA_x6K02T2PBJ9-9381439-9380456
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R5792 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106995399-107006072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107001443 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 139 (V139D)
Ref Sequence ENSEMBL: ENSMUSP00000150093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094109] [ENSMUST00000207280] [ENSMUST00000208147] [ENSMUST00000211432] [ENSMUST00000214105] [ENSMUST00000216375]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094109
AA Change: V139D

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091656
Gene: ENSMUSG00000070417
AA Change: V139D

DomainStartEndE-ValueType
Pfam:7tm_4 31 313 9.2e-53 PFAM
Pfam:7tm_1 42 295 3e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207280
AA Change: V139D

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208147
AA Change: V139D

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211432
AA Change: V139D

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214105
AA Change: V139D

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216375
AA Change: V139D

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217764
Meta Mutation Damage Score 0.2171 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (56/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,521 I296F possibly damaging Het
Adamts19 C T 18: 58,837,512 T56M possibly damaging Het
Armc4 T C 18: 7,217,965 N583S probably benign Het
Axdnd1 T G 1: 156,341,889 E802D probably damaging Het
Birc6 T C 17: 74,631,053 V2630A probably benign Het
Capn5 A T 7: 98,131,195 F323I probably benign Het
Cdc25b A G 2: 131,191,759 E206G probably damaging Het
Cmah T G 13: 24,456,915 N382K probably benign Het
Col11a1 A T 3: 114,131,593 D25V probably damaging Het
Cyp2d41-ps G T 15: 82,779,220 noncoding transcript Het
Cyp3a59 A G 5: 146,099,851 K288E possibly damaging Het
Cyr61 T C 3: 145,648,658 D166G probably benign Het
Dclre1a A C 19: 56,529,590 I1019S probably damaging Het
Fat2 G T 11: 55,262,325 A3687D possibly damaging Het
Flg2 T A 3: 93,203,497 V944E unknown Het
Galntl5 T C 5: 25,198,463 V177A possibly damaging Het
Gm12695 T C 4: 96,728,283 T438A probably benign Het
Gm14295 A T 2: 176,811,014 N766Y probably benign Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm2431 C T 7: 142,258,332 G8E unknown Het
Gm5435 T A 12: 82,495,426 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grip1 T C 10: 119,985,480 I350T probably benign Het
Guf1 T A 5: 69,560,486 F196I probably damaging Het
Kcng4 G T 8: 119,626,279 D297E probably damaging Het
Khdrbs2 G A 1: 32,472,692 R246Q probably damaging Het
Layn T C 9: 51,068,161 E148G probably damaging Het
Lrig3 T A 10: 126,009,919 V739E probably damaging Het
Lyg1 A G 1: 37,947,267 W129R probably benign Het
Nup210l C T 3: 90,199,857 T1567I probably damaging Het
Nus1 T A 10: 52,429,256 L12* probably null Het
Olfr354 A G 2: 36,907,101 I52V probably benign Het
Otop1 A G 5: 38,297,916 N218S probably benign Het
Pcif1 T A 2: 164,885,379 N90K probably damaging Het
Phf2 T C 13: 48,820,042 probably null Het
Piezo2 T A 18: 63,146,856 I215F probably damaging Het
Pitpnm2 G T 5: 124,130,321 C553* probably null Het
Prdm1 A G 10: 44,450,228 V115A probably damaging Het
Prkdc A G 16: 15,816,752 D3587G probably damaging Het
Sez6l A T 5: 112,422,024 Y883* probably null Het
Sh3rf2 A C 18: 42,111,138 H223P probably damaging Het
Slco1a5 C T 6: 142,242,113 C500Y probably damaging Het
Slf1 T A 13: 77,066,737 H610L probably benign Het
Syn3 T C 10: 86,294,628 *244W probably null Het
Sytl2 A T 7: 90,375,689 D295V probably damaging Het
Tnfrsf1a T A 6: 125,358,077 C44S probably damaging Het
Ttc6 T G 12: 57,673,204 L854V possibly damaging Het
Ttn T C 2: 76,766,258 I18358V probably benign Het
Vmn2r108 A G 17: 20,463,136 V602A probably damaging Het
Zap70 A G 1: 36,779,009 probably benign Het
Zfhx2 T C 14: 55,066,846 E1227G possibly damaging Het
Znhit3 G A 11: 84,916,084 probably null Het
Zpbp2 A G 11: 98,551,410 probably benign Het
Other mutations in Olfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Olfr2 APN 7 107001423 missense probably damaging 1.00
IGL02620:Olfr2 APN 7 107001618 nonsense probably null
IGL02942:Olfr2 APN 7 107001354 missense possibly damaging 0.88
R1171:Olfr2 UTSW 7 107001584 missense probably benign
R1956:Olfr2 UTSW 7 107001135 missense probably damaging 1.00
R2128:Olfr2 UTSW 7 107001248 missense probably damaging 1.00
R2342:Olfr2 UTSW 7 107000909 missense probably benign
R2351:Olfr2 UTSW 7 107001676 nonsense probably null
R3752:Olfr2 UTSW 7 107001475 nonsense probably null
R4197:Olfr2 UTSW 7 107001038 missense probably damaging 0.97
R4237:Olfr2 UTSW 7 107001329 missense probably damaging 1.00
R4787:Olfr2 UTSW 7 107001086 missense probably benign 0.00
R4795:Olfr2 UTSW 7 107001335 missense probably damaging 1.00
R4796:Olfr2 UTSW 7 107001335 missense probably damaging 1.00
R5268:Olfr2 UTSW 7 107000904 missense probably benign 0.00
R5412:Olfr2 UTSW 7 107001635 missense probably damaging 0.99
R5474:Olfr2 UTSW 7 107001089 missense probably damaging 0.98
R5542:Olfr2 UTSW 7 107001079 missense probably damaging 1.00
R6149:Olfr2 UTSW 7 107001600 missense probably benign
R7552:Olfr2 UTSW 7 107001327 missense probably benign
R7838:Olfr2 UTSW 7 107001307 nonsense probably null
R8177:Olfr2 UTSW 7 107001456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTAAGCTCTGCTGTGGAC -3'
(R):5'- TCCTGGAGATTTGGTATGTCAC -3'

Sequencing Primer
(F):5'- AAGCTCTGCTGTGGACATGTCAG -3'
(R):5'- ACGATTCCTAAGATGCTTGCTG -3'
Posted On2016-12-15