Mutagenetix > Incidental Mutations

Incidental Mutation 'R5792:Kcng4'

447027

Institutional Source

Beutler Lab

Gene Symbol

Kcng4

Ensembl Gene

ENSMUSG00000045246

Gene Name

potassium voltage-gated channel, subfamily G, member 4

Synonyms

KV6.4, 4921535I01Rik, KV6.3

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5792 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119623854-119635680 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 119626279 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 297 (D297E)

Ref Sequence

ENSEMBL: ENSMUSP00000129687 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061828] [ENSMUST00000164382]

Predicted Effect

probably damaging
Transcript: ENSMUST00000061828
AA Change: D297E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000056552
Gene: ENSMUSG00000045246
AA Change: D297E

Domain	Start	End	E-Value	Type
BTB	58	168	7.13e-3	SMART
Pfam:Ion_trans	218	462	1.2e-40	PFAM
Pfam:Ion_trans_2	370	457	7e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000164382
AA Change: D297E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129687
Gene: ENSMUSG00000045246
AA Change: D297E

Domain	Start	End	E-Value	Type
BTB	58	168	7.13e-3	SMART
Pfam:Ion_trans	262	451	6.6e-29	PFAM
Pfam:Ion_trans_2	371	457	1.7e-13	PFAM

Meta Mutation Damage Score

0.8723

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

95% (56/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member functions as a modulatory subunit. The gene has strong expression in brain. Multiple alternatively spliced variants have been found in normal and cancerous tissues. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,521	I296F	possibly damaging	Het
Adamts19	C	T	18: 58,837,512	T56M	possibly damaging	Het
Armc4	T	C	18: 7,217,965	N583S	probably benign	Het
Axdnd1	T	G	1: 156,341,889	E802D	probably damaging	Het
Birc6	T	C	17: 74,631,053	V2630A	probably benign	Het
Capn5	A	T	7: 98,131,195	F323I	probably benign	Het
Cdc25b	A	G	2: 131,191,759	E206G	probably damaging	Het
Cmah	T	G	13: 24,456,915	N382K	probably benign	Het
Col11a1	A	T	3: 114,131,593	D25V	probably damaging	Het
Cyp2d41-ps	G	T	15: 82,779,220		noncoding transcript	Het
Cyp3a59	A	G	5: 146,099,851	K288E	possibly damaging	Het
Cyr61	T	C	3: 145,648,658	D166G	probably benign	Het
Dclre1a	A	C	19: 56,529,590	I1019S	probably damaging	Het
Fat2	G	T	11: 55,262,325	A3687D	possibly damaging	Het
Flg2	T	A	3: 93,203,497	V944E	unknown	Het
Galntl5	T	C	5: 25,198,463	V177A	possibly damaging	Het
Gm12695	T	C	4: 96,728,283	T438A	probably benign	Het
Gm14295	A	T	2: 176,811,014	N766Y	probably benign	Het
Gm15433	T	A	1: 84,964,112		noncoding transcript	Het
Gm2431	C	T	7: 142,258,332	G8E	unknown	Het
Gm5435	T	A	12: 82,495,426		noncoding transcript	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Grip1	T	C	10: 119,985,480	I350T	probably benign	Het
Guf1	T	A	5: 69,560,486	F196I	probably damaging	Het
Khdrbs2	G	A	1: 32,472,692	R246Q	probably damaging	Het
Layn	T	C	9: 51,068,161	E148G	probably damaging	Het
Lrig3	T	A	10: 126,009,919	V739E	probably damaging	Het
Lyg1	A	G	1: 37,947,267	W129R	probably benign	Het
Nup210l	C	T	3: 90,199,857	T1567I	probably damaging	Het
Nus1	T	A	10: 52,429,256	L12*	probably null	Het
Olfr2	A	T	7: 107,001,443	V139D	possibly damaging	Het
Olfr354	A	G	2: 36,907,101	I52V	probably benign	Het
Otop1	A	G	5: 38,297,916	N218S	probably benign	Het
Pcif1	T	A	2: 164,885,379	N90K	probably damaging	Het
Phf2	T	C	13: 48,820,042		probably null	Het
Piezo2	T	A	18: 63,146,856	I215F	probably damaging	Het
Pitpnm2	G	T	5: 124,130,321	C553*	probably null	Het
Prdm1	A	G	10: 44,450,228	V115A	probably damaging	Het
Prkdc	A	G	16: 15,816,752	D3587G	probably damaging	Het
Sez6l	A	T	5: 112,422,024	Y883*	probably null	Het
Sh3rf2	A	C	18: 42,111,138	H223P	probably damaging	Het
Slco1a5	C	T	6: 142,242,113	C500Y	probably damaging	Het
Slf1	T	A	13: 77,066,737	H610L	probably benign	Het
Syn3	T	C	10: 86,294,628	*244W	probably null	Het
Sytl2	A	T	7: 90,375,689	D295V	probably damaging	Het
Tnfrsf1a	T	A	6: 125,358,077	C44S	probably damaging	Het
Ttc6	T	G	12: 57,673,204	L854V	possibly damaging	Het
Ttn	T	C	2: 76,766,258	I18358V	probably benign	Het
Vmn2r108	A	G	17: 20,463,136	V602A	probably damaging	Het
Zap70	A	G	1: 36,779,009		probably benign	Het
Zfhx2	T	C	14: 55,066,846	E1227G	possibly damaging	Het
Znhit3	G	A	11: 84,916,084		probably null	Het
Zpbp2	A	G	11: 98,551,410		probably benign	Het

Other mutations in Kcng4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Kcng4	APN	8	119626331	missense	probably benign	0.00
IGL01360:Kcng4	APN	8	119625677	missense	probably benign	0.40
IGL02094:Kcng4	APN	8	119633221	missense	probably damaging	0.98
IGL02205:Kcng4	APN	8	119626083	missense	probably damaging	0.99
IGL02892:Kcng4	APN	8	119633082	missense	probably benign
IGL02927:Kcng4	APN	8	119626322	missense	probably benign
IGL02954:Kcng4	APN	8	119633053	missense	probably benign
IGL03143:Kcng4	APN	8	119625770	missense	probably damaging	1.00
FR4449:Kcng4	UTSW	8	119633519	nonsense	probably null
FR4548:Kcng4	UTSW	8	119633519	nonsense	probably null
FR4737:Kcng4	UTSW	8	119633519	nonsense	probably null
FR4976:Kcng4	UTSW	8	119633519	nonsense	probably null
LCD18:Kcng4	UTSW	8	119633519	nonsense	probably null
R0017:Kcng4	UTSW	8	119633520	missense	probably damaging	1.00
R1777:Kcng4	UTSW	8	119633487	missense	probably benign	0.02
R1852:Kcng4	UTSW	8	119626208	missense	probably benign	0.01
R1967:Kcng4	UTSW	8	119632923	missense	probably damaging	1.00
R3886:Kcng4	UTSW	8	119633247	missense	probably benign	0.34
R4009:Kcng4	UTSW	8	119626085	missense	probably damaging	1.00
R5137:Kcng4	UTSW	8	119625878	missense	possibly damaging	0.88
R5987:Kcng4	UTSW	8	119626359	missense	probably damaging	1.00
R6339:Kcng4	UTSW	8	119632954	missense	probably damaging	1.00
R6379:Kcng4	UTSW	8	119633620	nonsense	probably null
R6430:Kcng4	UTSW	8	119633050	missense	probably damaging	0.96
R7847:Kcng4	UTSW	8	119626142	missense	probably damaging	1.00
X0024:Kcng4	UTSW	8	119633367	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCAGGAGACCAAACTCTCGG -3'
(R):5'- GGCTAACCCATTGCTTTTGTG -3'

Sequencing Primer
(F):5'- ACCAAACTCTCGGGCGCAG -3'
(R):5'- GGCTCTCACTCCAGGGAGAATG -3'

Posted On

2016-12-15