Mutagenetix > Incidental Mutations

Incidental Mutation 'R5792:Prdm1'

447029

Institutional Source

Beutler Lab

Gene Symbol

Prdm1

Ensembl Gene

ENSMUSG00000038151

Gene Name

PR domain containing 1, with ZNF domain

Synonyms

Blimp1, b2b1765Clo, Blimp-1, PRDI-BF1

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5792 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44437177-44528501 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44450228 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 115 (V115A)

Ref Sequence

ENSEMBL: ENSMUSP00000151237 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039174] [ENSMUST00000105490] [ENSMUST00000218369]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039174
AA Change: V133A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039248
Gene: ENSMUSG00000038151
AA Change: V133A

Domain	Start	End	E-Value	Type
SET	118	239	1.1e-19	SMART
low complexity region	359	393	N/A	INTRINSIC
low complexity region	541	556	N/A	INTRINSIC
ZnF_C2H2	606	628	6.42e-4	SMART
ZnF_C2H2	634	656	3.89e-3	SMART
ZnF_C2H2	662	684	7.26e-3	SMART
ZnF_C2H2	690	712	1.36e-2	SMART
ZnF_C2H2	718	738	1.12e2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105490
AA Change: V100A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101129
Gene: ENSMUSG00000038151
AA Change: V100A

Domain	Start	End	E-Value	Type
SET	85	206	1.1e-19	SMART
low complexity region	326	360	N/A	INTRINSIC
low complexity region	508	523	N/A	INTRINSIC
ZnF_C2H2	573	595	6.42e-4	SMART
ZnF_C2H2	601	623	3.89e-3	SMART
ZnF_C2H2	629	651	7.26e-3	SMART
ZnF_C2H2	657	679	1.36e-2	SMART
ZnF_C2H2	685	705	1.12e2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167340

Predicted Effect

probably damaging
Transcript: ENSMUST00000218369
AA Change: V115A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.7492

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

95% (56/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that acts as a repressor of beta-interferon gene expression. The protein binds specifically to the PRDI (positive regulatory domain I element) of the beta-IFN gene promoter. Transcription of this gene increases upon virus induction. Two alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality and impaired primordial germ cell development, while heterozygotes display a decreased numbers of primordial germ cells but normal migration. Conditional mutants display impaired plasma cell and pre-plasmamemory B cell development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,521	I296F	possibly damaging	Het
Adamts19	C	T	18: 58,837,512	T56M	possibly damaging	Het
Armc4	T	C	18: 7,217,965	N583S	probably benign	Het
Axdnd1	T	G	1: 156,341,889	E802D	probably damaging	Het
Birc6	T	C	17: 74,631,053	V2630A	probably benign	Het
Capn5	A	T	7: 98,131,195	F323I	probably benign	Het
Cdc25b	A	G	2: 131,191,759	E206G	probably damaging	Het
Cmah	T	G	13: 24,456,915	N382K	probably benign	Het
Col11a1	A	T	3: 114,131,593	D25V	probably damaging	Het
Cyp2d41-ps	G	T	15: 82,779,220		noncoding transcript	Het
Cyp3a59	A	G	5: 146,099,851	K288E	possibly damaging	Het
Cyr61	T	C	3: 145,648,658	D166G	probably benign	Het
Dclre1a	A	C	19: 56,529,590	I1019S	probably damaging	Het
Fat2	G	T	11: 55,262,325	A3687D	possibly damaging	Het
Flg2	T	A	3: 93,203,497	V944E	unknown	Het
Galntl5	T	C	5: 25,198,463	V177A	possibly damaging	Het
Gm12695	T	C	4: 96,728,283	T438A	probably benign	Het
Gm14295	A	T	2: 176,811,014	N766Y	probably benign	Het
Gm15433	T	A	1: 84,964,112		noncoding transcript	Het
Gm2431	C	T	7: 142,258,332	G8E	unknown	Het
Gm5435	T	A	12: 82,495,426		noncoding transcript	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Grip1	T	C	10: 119,985,480	I350T	probably benign	Het
Guf1	T	A	5: 69,560,486	F196I	probably damaging	Het
Kcng4	G	T	8: 119,626,279	D297E	probably damaging	Het
Khdrbs2	G	A	1: 32,472,692	R246Q	probably damaging	Het
Layn	T	C	9: 51,068,161	E148G	probably damaging	Het
Lrig3	T	A	10: 126,009,919	V739E	probably damaging	Het
Lyg1	A	G	1: 37,947,267	W129R	probably benign	Het
Nup210l	C	T	3: 90,199,857	T1567I	probably damaging	Het
Nus1	T	A	10: 52,429,256	L12*	probably null	Het
Olfr2	A	T	7: 107,001,443	V139D	possibly damaging	Het
Olfr354	A	G	2: 36,907,101	I52V	probably benign	Het
Otop1	A	G	5: 38,297,916	N218S	probably benign	Het
Pcif1	T	A	2: 164,885,379	N90K	probably damaging	Het
Phf2	T	C	13: 48,820,042		probably null	Het
Piezo2	T	A	18: 63,146,856	I215F	probably damaging	Het
Pitpnm2	G	T	5: 124,130,321	C553*	probably null	Het
Prkdc	A	G	16: 15,816,752	D3587G	probably damaging	Het
Sez6l	A	T	5: 112,422,024	Y883*	probably null	Het
Sh3rf2	A	C	18: 42,111,138	H223P	probably damaging	Het
Slco1a5	C	T	6: 142,242,113	C500Y	probably damaging	Het
Slf1	T	A	13: 77,066,737	H610L	probably benign	Het
Syn3	T	C	10: 86,294,628	*244W	probably null	Het
Sytl2	A	T	7: 90,375,689	D295V	probably damaging	Het
Tnfrsf1a	T	A	6: 125,358,077	C44S	probably damaging	Het
Ttc6	T	G	12: 57,673,204	L854V	possibly damaging	Het
Ttn	T	C	2: 76,766,258	I18358V	probably benign	Het
Vmn2r108	A	G	17: 20,463,136	V602A	probably damaging	Het
Zap70	A	G	1: 36,779,009		probably benign	Het
Zfhx2	T	C	14: 55,066,846	E1227G	possibly damaging	Het
Znhit3	G	A	11: 84,916,084		probably null	Het
Zpbp2	A	G	11: 98,551,410		probably benign	Het

Other mutations in Prdm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00657:Prdm1	APN	10	44441892	missense	probably damaging	1.00
IGL01331:Prdm1	APN	10	44441974	missense	possibly damaging	0.67
IGL02064:Prdm1	APN	10	44441342	missense	probably damaging	1.00
IGL02669:Prdm1	APN	10	44439884	missense	probably benign	0.28
IGL02944:Prdm1	APN	10	44441811	missense	probably benign
IGL03295:Prdm1	APN	10	44439870	missense	probably damaging	0.99
PIT4576001:Prdm1	UTSW	10	44458508	start codon destroyed	probably null	0.05
R0008:Prdm1	UTSW	10	44441679	missense	probably damaging	1.00
R0166:Prdm1	UTSW	10	44440091	missense	probably damaging	1.00
R0226:Prdm1	UTSW	10	44456696	missense	probably benign	0.03
R0284:Prdm1	UTSW	10	44456626	missense	probably damaging	1.00
R0398:Prdm1	UTSW	10	44439809	missense	probably damaging	1.00
R1200:Prdm1	UTSW	10	44450130	missense	probably damaging	1.00
R1405:Prdm1	UTSW	10	44439965	missense	probably damaging	1.00
R1405:Prdm1	UTSW	10	44439965	missense	probably damaging	1.00
R1438:Prdm1	UTSW	10	44442128	missense	probably benign	0.00
R1519:Prdm1	UTSW	10	44439986	nonsense	probably null
R1886:Prdm1	UTSW	10	44439758	missense	probably damaging	0.99
R2070:Prdm1	UTSW	10	44441412	missense	possibly damaging	0.82
R2508:Prdm1	UTSW	10	44446807	missense	probably benign	0.37
R3087:Prdm1	UTSW	10	44446827	missense	probably damaging	1.00
R3150:Prdm1	UTSW	10	44458492	splice site	probably null
R4165:Prdm1	UTSW	10	44441576	missense	probably benign	0.11
R4490:Prdm1	UTSW	10	44446907	nonsense	probably null
R4647:Prdm1	UTSW	10	44439690	missense	probably damaging	0.98
R4911:Prdm1	UTSW	10	44442052	missense	possibly damaging	0.90
R4925:Prdm1	UTSW	10	44440169	missense	probably damaging	1.00
R5153:Prdm1	UTSW	10	44450225	missense	possibly damaging	0.94
R5247:Prdm1	UTSW	10	44440102	missense	probably damaging	1.00
R6164:Prdm1	UTSW	10	44450195	missense	probably damaging	1.00
R6247:Prdm1	UTSW	10	44446786	splice site	probably null
R7196:Prdm1	UTSW	10	44456992	missense	probably benign	0.14
R7270:Prdm1	UTSW	10	44441570	missense	probably benign	0.07
R7384:Prdm1	UTSW	10	44458507	missense	probably benign	0.01
R7822:Prdm1	UTSW	10	44458482	missense	probably benign	0.01
Z1088:Prdm1	UTSW	10	44441925	missense	probably damaging	1.00
Z1176:Prdm1	UTSW	10	44446833	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCCTGCTGTGTTGAAAG -3'
(R):5'- CCCGGGACTATTTCAGTTTCAG -3'

Sequencing Primer
(F):5'- CCCTGCTGTGTTGAAAGGGAAC -3'
(R):5'- AGCTAGCTTGCCATCTCA -3'

Posted On

2016-12-15