Incidental Mutation 'R5792:Syn3'
ID447032
Institutional Source Beutler Lab
Gene Symbol Syn3
Ensembl Gene ENSMUSG00000059602
Gene Namesynapsin III
SynonymsSynapsin IIIa
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5792 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location86055125-86498896 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 86294628 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 244 (*244W)
Ref Sequence ENSEMBL: ENSMUSP00000113408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120638] [ENSMUST00000121789]
Predicted Effect probably benign
Transcript: ENSMUST00000120638
SMART Domains Protein: ENSMUSP00000113720
Gene: ENSMUSG00000059602

DomainStartEndE-ValueType
Pfam:Synapsin_N 1 32 8.7e-22 PFAM
low complexity region 47 66 N/A INTRINSIC
low complexity region 80 88 N/A INTRINSIC
Pfam:Synapsin 89 190 1.8e-46 PFAM
Pfam:Synapsin_C 192 394 6.8e-141 PFAM
low complexity region 418 485 N/A INTRINSIC
low complexity region 535 551 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121789
AA Change: *244W
SMART Domains Protein: ENSMUSP00000113408
Gene: ENSMUSG00000059602
AA Change: *244W

DomainStartEndE-ValueType
Pfam:Synapsin_N 1 32 2.2e-25 PFAM
low complexity region 47 66 N/A INTRINSIC
Pfam:Synapsin 87 190 3.6e-63 PFAM
Pfam:Synapsin_C 192 242 6.7e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145864
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (56/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. The protein encoded by this gene shares the synapsin family domain model, with domains A, C, and E exhibiting the highest degree of conservation. The protein contains a unique domain J, located between domains C and E. Based on this gene's localization to 22q12.3, a possible schizophrenia susceptibility locus, and the established neurobiological roles of the synapsins, this family member may represent a candidate gene for schizophrenia. The TIMP3 gene is located within an intron of this gene and is transcribed in the opposite direction. Alternative splicing of this gene results in multiple splice variants that encode different isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display altered neurotransmitter release, reduced synaptic depression, and a specific delay in early axon outgrowth in cultured hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,521 I296F possibly damaging Het
Adamts19 C T 18: 58,837,512 T56M possibly damaging Het
Armc4 T C 18: 7,217,965 N583S probably benign Het
Axdnd1 T G 1: 156,341,889 E802D probably damaging Het
Birc6 T C 17: 74,631,053 V2630A probably benign Het
Capn5 A T 7: 98,131,195 F323I probably benign Het
Cdc25b A G 2: 131,191,759 E206G probably damaging Het
Cmah T G 13: 24,456,915 N382K probably benign Het
Col11a1 A T 3: 114,131,593 D25V probably damaging Het
Cyp2d41-ps G T 15: 82,779,220 noncoding transcript Het
Cyp3a59 A G 5: 146,099,851 K288E possibly damaging Het
Cyr61 T C 3: 145,648,658 D166G probably benign Het
Dclre1a A C 19: 56,529,590 I1019S probably damaging Het
Fat2 G T 11: 55,262,325 A3687D possibly damaging Het
Flg2 T A 3: 93,203,497 V944E unknown Het
Galntl5 T C 5: 25,198,463 V177A possibly damaging Het
Gm12695 T C 4: 96,728,283 T438A probably benign Het
Gm14295 A T 2: 176,811,014 N766Y probably benign Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm2431 C T 7: 142,258,332 G8E unknown Het
Gm5435 T A 12: 82,495,426 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grip1 T C 10: 119,985,480 I350T probably benign Het
Guf1 T A 5: 69,560,486 F196I probably damaging Het
Kcng4 G T 8: 119,626,279 D297E probably damaging Het
Khdrbs2 G A 1: 32,472,692 R246Q probably damaging Het
Layn T C 9: 51,068,161 E148G probably damaging Het
Lrig3 T A 10: 126,009,919 V739E probably damaging Het
Lyg1 A G 1: 37,947,267 W129R probably benign Het
Nup210l C T 3: 90,199,857 T1567I probably damaging Het
Nus1 T A 10: 52,429,256 L12* probably null Het
Olfr2 A T 7: 107,001,443 V139D possibly damaging Het
Olfr354 A G 2: 36,907,101 I52V probably benign Het
Otop1 A G 5: 38,297,916 N218S probably benign Het
Pcif1 T A 2: 164,885,379 N90K probably damaging Het
Phf2 T C 13: 48,820,042 probably null Het
Piezo2 T A 18: 63,146,856 I215F probably damaging Het
Pitpnm2 G T 5: 124,130,321 C553* probably null Het
Prdm1 A G 10: 44,450,228 V115A probably damaging Het
Prkdc A G 16: 15,816,752 D3587G probably damaging Het
Sez6l A T 5: 112,422,024 Y883* probably null Het
Sh3rf2 A C 18: 42,111,138 H223P probably damaging Het
Slco1a5 C T 6: 142,242,113 C500Y probably damaging Het
Slf1 T A 13: 77,066,737 H610L probably benign Het
Sytl2 A T 7: 90,375,689 D295V probably damaging Het
Tnfrsf1a T A 6: 125,358,077 C44S probably damaging Het
Ttc6 T G 12: 57,673,204 L854V possibly damaging Het
Ttn T C 2: 76,766,258 I18358V probably benign Het
Vmn2r108 A G 17: 20,463,136 V602A probably damaging Het
Zap70 A G 1: 36,779,009 probably benign Het
Zfhx2 T C 14: 55,066,846 E1227G possibly damaging Het
Znhit3 G A 11: 84,916,084 probably null Het
Zpbp2 A G 11: 98,551,410 probably benign Het
Other mutations in Syn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Syn3 APN 10 86354416 missense probably damaging 1.00
IGL02391:Syn3 APN 10 86064906 missense probably benign 0.22
IGL02598:Syn3 APN 10 86467199 missense probably damaging 0.99
IGL03007:Syn3 APN 10 86064914 missense possibly damaging 0.57
IGL03379:Syn3 APN 10 86064872 missense possibly damaging 0.80
R0234:Syn3 UTSW 10 86448886 missense possibly damaging 0.64
R0234:Syn3 UTSW 10 86448886 missense possibly damaging 0.64
R1577:Syn3 UTSW 10 86448864 critical splice donor site probably null
R1597:Syn3 UTSW 10 86135044 missense probably benign 0.16
R1699:Syn3 UTSW 10 86080211 missense probably damaging 1.00
R1916:Syn3 UTSW 10 86354344 critical splice donor site probably null
R2006:Syn3 UTSW 10 86073233 missense probably benign 0.20
R2025:Syn3 UTSW 10 86466982 missense probably damaging 0.97
R4413:Syn3 UTSW 10 86055592 unclassified probably benign
R4904:Syn3 UTSW 10 86467086 missense possibly damaging 0.91
R5050:Syn3 UTSW 10 86407668 missense probably benign 0.05
R5286:Syn3 UTSW 10 86351564 missense possibly damaging 0.93
R5449:Syn3 UTSW 10 86351570 missense probably damaging 1.00
R5507:Syn3 UTSW 10 86080226 missense probably benign 0.01
R6525:Syn3 UTSW 10 86467052 missense probably damaging 0.99
R6605:Syn3 UTSW 10 86057564 missense unknown
R7000:Syn3 UTSW 10 86080252 missense probably damaging 1.00
R7619:Syn3 UTSW 10 86057564 missense unknown
R7661:Syn3 UTSW 10 86069076 missense probably damaging 1.00
R7710:Syn3 UTSW 10 86407670 missense probably damaging 0.98
R7730:Syn3 UTSW 10 86448909 missense probably benign 0.05
R7798:Syn3 UTSW 10 86080253 missense probably damaging 1.00
R7819:Syn3 UTSW 10 86055540 unclassified probably benign
R7899:Syn3 UTSW 10 86064929 missense possibly damaging 0.94
R8248:Syn3 UTSW 10 86135021 missense probably benign 0.13
R8342:Syn3 UTSW 10 86467027 missense probably damaging 0.99
R8494:Syn3 UTSW 10 86354401 missense probably damaging 1.00
X0023:Syn3 UTSW 10 86354477 missense probably benign 0.35
Z1177:Syn3 UTSW 10 86080209 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTTTGTTCAGAGAGCCACAG -3'
(R):5'- TGTGCACTGAAATAAGATGCAC -3'

Sequencing Primer
(F):5'- CTTTGTTCAGAGAGCCACAGAATATG -3'
(R):5'- GATGCACAAGGCCACAGTGTC -3'
Posted On2016-12-15