Mutagenetix > Incidental Mutation

Incidental Mutation 'R0544:Sdk2'

44704

Institutional Source

Beutler Lab

Gene Symbol

Sdk2

Ensembl Gene

ENSMUSG00000041592

Gene Name

sidekick cell adhesion molecule 2

Synonyms

5330435L01Rik, 4632412F08Rik

MMRRC Submission

038736-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R0544 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113776374-114067046 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 113781010 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 2104 (Y2104C)

Ref Sequence

ENSEMBL: ENSMUSP00000038972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041627]

AlphaFold

Q6V4S5

Predicted Effect

probably damaging
Transcript: ENSMUST00000041627
AA Change: Y2104C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: Y2104C

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	884	3.45e-5	SMART
FN3	899	981	2.36e-12	SMART
FN3	997	1084	1.64e-6	SMART
FN3	1101	1188	8.83e-12	SMART
FN3	1204	1289	3.62e-8	SMART
FN3	1305	1388	1.74e-10	SMART
FN3	1404	1489	8.23e-12	SMART
FN3	1506	1612	3.62e-8	SMART
FN3	1628	1713	1.15e-10	SMART
FN3	1728	1815	2.17e-11	SMART
FN3	1829	1913	5.04e-7	SMART
transmembrane domain	1935	1957	N/A	INTRINSIC
low complexity region	2138	2153	N/A	INTRINSIC

Meta Mutation Damage Score

0.1297

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.6%

Validation Efficiency

98% (97/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930012K11Rik	A	T	14: 70,157,314	F130L	probably benign	Het
Aatf	C	T	11: 84,423,005	R511Q	probably benign	Het
Acot12	A	T	13: 91,784,656	D516V	probably benign	Het
Adgrb2	T	C	4: 130,017,542	V1207A	probably damaging	Het
Akap9	A	G	5: 4,069,185	D3564G	probably benign	Het
Arl8b	C	T	6: 108,783,228		probably benign	Het
Atf6b	T	C	17: 34,648,299		probably null	Het
Atrn	G	A	2: 130,986,826	G1097D	probably damaging	Het
Btbd6	A	G	12: 112,977,082	E61G	probably damaging	Het
Car15	A	G	16: 17,835,816		probably benign	Het
Car5b	G	A	X: 163,979,301	R282C	probably damaging	Het
Carmil2	C	T	8: 105,691,235	A654V	probably damaging	Het
Cbwd1	A	G	19: 24,949,211	Y159H	possibly damaging	Het
Ccdc88b	A	G	19: 6,857,266	L124P	probably damaging	Het
Ccnd1	A	G	7: 144,937,286		probably benign	Het
Cd3eap	G	T	7: 19,359,141	P38Q	probably damaging	Het
Cenph	A	G	13: 100,772,741	S53P	probably damaging	Het
Chrm3	T	A	13: 9,877,579	I474F	probably damaging	Het
Cln8	T	A	8: 14,896,769	V261E	probably benign	Het
Coa6	A	G	8: 126,422,760	D25G	probably benign	Het
Col4a1	T	G	8: 11,226,487		probably benign	Het
Cpxm1	T	C	2: 130,393,135	H588R	probably damaging	Het
Cul7	T	C	17: 46,663,544	L1516P	possibly damaging	Het
Dcdc5	A	G	2: 106,351,564		noncoding transcript	Het
Ddx5	T	C	11: 106,782,462		probably benign	Het
Dhx16	C	A	17: 35,881,659	P161Q	probably benign	Het
Dpy19l1	A	T	9: 24,485,110		probably benign	Het
Fastkd5	A	G	2: 130,615,296	V458A	probably damaging	Het
Fhit	A	G	14: 9,870,172	V99A	probably damaging	Het
Fndc3a	A	T	14: 72,557,622		probably benign	Het
Foxd4	A	T	19: 24,899,818	S339R	possibly damaging	Het
Gm10842	T	A	11: 105,147,054	D54E	unknown	Het
Gns	T	A	10: 121,376,267	Y94*	probably null	Het
Gp2	A	G	7: 119,454,496	W81R	probably benign	Het
Hdac5	T	G	11: 102,196,096	Q46P	probably damaging	Het
Homer2	A	C	7: 81,649,678	V13G	probably damaging	Het
Irs3	A	G	5: 137,643,839	S446P	probably benign	Het
Ism2	G	T	12: 87,285,339	D141E	probably damaging	Het
Jak1	T	A	4: 101,191,625	M19L	probably benign	Het
Kcnd3	C	A	3: 105,658,759	R419S	probably damaging	Het
Lamb1	T	C	12: 31,282,695	F272S	probably damaging	Het
Ldlrad2	T	G	4: 137,572,268	T82P	possibly damaging	Het
Lrp2	T	C	2: 69,491,931	K1885E	probably benign	Het
Mbd5	T	C	2: 49,257,209	V477A	possibly damaging	Het
Mrps33	A	T	6: 39,805,554	M11K	possibly damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Myom2	T	A	8: 15,069,796	V184E	probably damaging	Het
Ncor1	C	A	11: 62,333,776	G1210V	probably damaging	Het
Ncor1	C	T	11: 62,333,777	G1210R	probably damaging	Het
Nlrp4a	A	G	7: 26,457,130	D760G	probably benign	Het
Noc4l	A	G	5: 110,651,123	V231A	possibly damaging	Het
Olfr1056	T	C	2: 86,355,663	T240A	probably damaging	Het
Olfr1217	T	C	2: 89,023,826	Y59C	probably damaging	Het
Olfr1306	A	T	2: 111,912,560	Y123*	probably null	Het
Olfr1450	A	G	19: 12,953,702	T38A	possibly damaging	Het
Olfr193	T	A	16: 59,110,225	K128N	probably benign	Het
Olfr521	T	C	7: 99,767,660	I166T	probably benign	Het
Olfr598	T	A	7: 103,328,651	I55N	probably damaging	Het
Olfr733	A	T	14: 50,298,682	V209E	probably benign	Het
Padi4	GCTGCGTACCTCCAC	GC	4: 140,748,449		probably benign	Het
Patj	T	A	4: 98,569,110	M1283K	probably damaging	Het
Pkd1	C	T	17: 24,585,683	T790I	probably damaging	Het
Plod3	C	A	5: 136,991,611	T526K	probably benign	Het
Plxnb2	C	A	15: 89,158,613		probably benign	Het
Pramel1	T	A	4: 143,397,605	D283E	possibly damaging	Het
Prpf40a	T	C	2: 53,141,651		probably benign	Het
Psg23	A	T	7: 18,614,682	Y67N	probably damaging	Het
Rftn1	T	A	17: 49,994,261	Q242L	possibly damaging	Het
Rp1l1	A	T	14: 64,032,066	E1700D	probably benign	Het
Scube3	T	C	17: 28,164,153	F435S	probably damaging	Het
Sept11	A	G	5: 93,165,368	E358G	possibly damaging	Het
Sh3bp1	T	C	15: 78,905,775	L246P	probably damaging	Het
Sis	T	C	3: 72,951,642	Y352C	probably damaging	Het
Skint1	T	C	4: 112,021,365	S165P	probably damaging	Het
Skint10	C	T	4: 112,728,811		probably benign	Het
Slc1a2	A	T	2: 102,756,072	R340S	probably damaging	Het
Slc26a3	C	A	12: 31,447,740	Q48K	probably benign	Het
Slc5a2	A	T	7: 128,269,999	Y317F	probably damaging	Het
Sorbs3	T	A	14: 70,193,926	T262S	probably benign	Het
Tas2r118	G	T	6: 23,969,401	S220R	probably damaging	Het
Terf2ip	C	A	8: 112,015,342	Q223K	possibly damaging	Het
Tespa1	A	G	10: 130,360,811	Q206R	probably damaging	Het
Tex10	T	C	4: 48,462,766		probably null	Het
Tle1	T	A	4: 72,124,990	K547N	probably damaging	Het
Tmem131l	T	A	3: 83,898,546	Q1530L	probably damaging	Het
Tomm20l	A	G	12: 71,123,077	E145G	possibly damaging	Het
Tra2a	C	T	6: 49,250,951		probably benign	Het
Trim32	G	A	4: 65,613,254	R16Q	probably damaging	Het
Trim37	T	A	11: 87,145,502	Y121*	probably null	Het
Tube1	C	T	10: 39,140,945		probably null	Het
Usp6nl	T	A	2: 6,421,009	V187D	probably damaging	Het
Vmn1r13	T	C	6: 57,210,263	F136L	probably benign	Het
Vmn1r201	A	T	13: 22,475,146	I177F	probably benign	Het
Vmn1r203	A	T	13: 22,524,273	T75S	possibly damaging	Het
Vmn1r225	C	T	17: 20,502,456	S53L	probably benign	Het
Xab2	A	T	8: 3,610,994	W707R	probably damaging	Het
Zfp808	T	C	13: 62,169,434		probably benign	Het

Other mutations in Sdk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Sdk2	APN	11	113854384	missense	possibly damaging	0.86
IGL01063:Sdk2	APN	11	113830842	missense	probably damaging	1.00
IGL01291:Sdk2	APN	11	113843080	missense	probably benign
IGL01316:Sdk2	APN	11	113867965	missense	probably benign	0.09
IGL01614:Sdk2	APN	11	113793858	missense	probably damaging	1.00
IGL01998:Sdk2	APN	11	113838532	missense	probably damaging	0.98
IGL02014:Sdk2	APN	11	113838494	missense	probably damaging	1.00
IGL02095:Sdk2	APN	11	113834830	missense	probably damaging	1.00
IGL02115:Sdk2	APN	11	113834813	splice site	probably benign
IGL02543:Sdk2	APN	11	113868921	missense	possibly damaging	0.90
IGL02976:Sdk2	APN	11	113851842	missense	probably damaging	1.00
IGL03001:Sdk2	APN	11	113821626	missense	probably benign	0.00
IGL03122:Sdk2	APN	11	113842068	missense	probably damaging	1.00
IGL03183:Sdk2	APN	11	113850984	missense	probably benign	0.19
IGL03222:Sdk2	APN	11	113838431	missense	probably benign	0.01
IGL03310:Sdk2	APN	11	113793325	missense	possibly damaging	0.77
Curtailed	UTSW	11	113851800	missense	probably damaging	1.00
Trimmed	UTSW	11	113856696	nonsense	probably null
ANU05:Sdk2	UTSW	11	113843080	missense	probably benign
BB008:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
BB018:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0088:Sdk2	UTSW	11	113827086	missense	possibly damaging	0.74
R0096:Sdk2	UTSW	11	113903144	splice site	probably benign
R0386:Sdk2	UTSW	11	113893464	missense	probably damaging	0.96
R0396:Sdk2	UTSW	11	113829967	missense	probably benign	0.04
R0409:Sdk2	UTSW	11	113850891	splice site	probably benign
R0416:Sdk2	UTSW	11	113803203	missense	probably damaging	1.00
R0456:Sdk2	UTSW	11	113791466	missense	possibly damaging	0.93
R0691:Sdk2	UTSW	11	113794920	splice site	probably null
R0711:Sdk2	UTSW	11	113903144	splice site	probably benign
R0717:Sdk2	UTSW	11	113832326	missense	probably damaging	1.00
R0780:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R0831:Sdk2	UTSW	11	113832258	missense	probably damaging	0.96
R0853:Sdk2	UTSW	11	113821415	missense	probably benign	0.00
R0865:Sdk2	UTSW	11	113850922	missense	probably benign	0.12
R0930:Sdk2	UTSW	11	113838445	missense	probably benign	0.01
R0964:Sdk2	UTSW	11	113806417	splice site	probably benign
R1051:Sdk2	UTSW	11	113838646	synonymous	silent
R1052:Sdk2	UTSW	11	113838646	synonymous	silent
R1054:Sdk2	UTSW	11	113838646	synonymous	silent
R1055:Sdk2	UTSW	11	113838646	synonymous	silent
R1077:Sdk2	UTSW	11	113838646	synonymous	silent
R1079:Sdk2	UTSW	11	113838646	synonymous	silent
R1115:Sdk2	UTSW	11	113838646	synonymous	silent
R1186:Sdk2	UTSW	11	113838646	synonymous	silent
R1187:Sdk2	UTSW	11	113838646	synonymous	silent
R1337:Sdk2	UTSW	11	113832331	missense	possibly damaging	0.79
R1430:Sdk2	UTSW	11	113838646	synonymous	silent
R1433:Sdk2	UTSW	11	113795045	missense	probably damaging	0.99
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1497:Sdk2	UTSW	11	113893575	splice site	probably benign
R1514:Sdk2	UTSW	11	113838646	synonymous	silent
R1529:Sdk2	UTSW	11	113838646	synonymous	silent
R1596:Sdk2	UTSW	11	113838609	splice site	probably benign
R1680:Sdk2	UTSW	11	113791436	missense	possibly damaging	0.47
R1680:Sdk2	UTSW	11	113838646	synonymous	silent
R1770:Sdk2	UTSW	11	113793741	missense	probably benign	0.05
R1858:Sdk2	UTSW	11	113838646	synonymous	silent
R1866:Sdk2	UTSW	11	113838646	synonymous	silent
R1874:Sdk2	UTSW	11	113834956	missense	probably benign	0.00
R1899:Sdk2	UTSW	11	113838646	synonymous	silent
R1905:Sdk2	UTSW	11	113838646	synonymous	silent
R1907:Sdk2	UTSW	11	113838646	synonymous	silent
R1913:Sdk2	UTSW	11	113856726	missense	possibly damaging	0.77
R1964:Sdk2	UTSW	11	113781017	nonsense	probably null
R2055:Sdk2	UTSW	11	113850954	missense	probably damaging	1.00
R2059:Sdk2	UTSW	11	113854332	missense	probably damaging	1.00
R2093:Sdk2	UTSW	11	113943122	missense	probably damaging	1.00
R2256:Sdk2	UTSW	11	113830794	missense	probably benign	0.44
R3720:Sdk2	UTSW	11	113800244	missense	probably damaging	1.00
R3795:Sdk2	UTSW	11	113856696	nonsense	probably null
R4037:Sdk2	UTSW	11	113795055	missense	probably damaging	1.00
R4171:Sdk2	UTSW	11	113866989	splice site	probably null
R4717:Sdk2	UTSW	11	113854369	missense	probably damaging	0.96
R4758:Sdk2	UTSW	11	113827054	missense	possibly damaging	0.87
R4857:Sdk2	UTSW	11	113821382	nonsense	probably null
R4924:Sdk2	UTSW	11	113857758	missense	probably damaging	1.00
R5015:Sdk2	UTSW	11	113793761	missense	probably damaging	1.00
R5171:Sdk2	UTSW	11	113850982	missense	probably benign	0.01
R5239:Sdk2	UTSW	11	113868033	missense	probably damaging	1.00
R5243:Sdk2	UTSW	11	113825086	missense	possibly damaging	0.76
R5279:Sdk2	UTSW	11	113867031	missense	probably benign	0.31
R5535:Sdk2	UTSW	11	113943158	missense	possibly damaging	0.80
R5634:Sdk2	UTSW	11	113851714	missense	probably damaging	1.00
R5637:Sdk2	UTSW	11	113833179	missense	probably damaging	1.00
R5726:Sdk2	UTSW	11	113851800	missense	probably damaging	1.00
R5793:Sdk2	UTSW	11	113868952	missense	possibly damaging	0.46
R5798:Sdk2	UTSW	11	113827116	missense	probably damaging	1.00
R5834:Sdk2	UTSW	11	113854273	missense	probably damaging	1.00
R5863:Sdk2	UTSW	11	113834984	missense	probably damaging	0.98
R5869:Sdk2	UTSW	11	113851882	missense	probably damaging	0.96
R5875:Sdk2	UTSW	11	113830059	missense	probably benign	0.00
R5953:Sdk2	UTSW	11	113793744	missense	probably damaging	1.00
R5991:Sdk2	UTSW	11	113943254	missense	probably damaging	0.97
R6018:Sdk2	UTSW	11	113830063	missense	probably benign	0.00
R6116:Sdk2	UTSW	11	113854364	missense	probably damaging	0.99
R6328:Sdk2	UTSW	11	113793755	missense	probably damaging	1.00
R6348:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R6383:Sdk2	UTSW	11	113832265	missense	probably damaging	1.00
R6824:Sdk2	UTSW	11	113867934	missense	probably benign	0.43
R6835:Sdk2	UTSW	11	113830048	missense	probably damaging	0.98
R6853:Sdk2	UTSW	11	113780929	missense	probably damaging	0.99
R6912:Sdk2	UTSW	11	113903120	missense	probably benign	0.03
R7000:Sdk2	UTSW	11	113803169	missense	probably damaging	1.00
R7099:Sdk2	UTSW	11	113834905	missense	probably damaging	0.98
R7102:Sdk2	UTSW	11	113842690	nonsense	probably null
R7177:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7381:Sdk2	UTSW	11	113838489	missense	probably damaging	0.98
R7412:Sdk2	UTSW	11	113868083	splice site	probably null
R7504:Sdk2	UTSW	11	113867967	missense	possibly damaging	0.50
R7552:Sdk2	UTSW	11	113873213	missense	possibly damaging	0.63
R7604:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7647:Sdk2	UTSW	11	113793737	missense	probably damaging	1.00
R7897:Sdk2	UTSW	11	113873201	missense	possibly damaging	0.50
R7931:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R7998:Sdk2	UTSW	11	113859938	missense	probably benign	0.18
R8052:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8053:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8084:Sdk2	UTSW	11	113827089	missense	possibly damaging	0.67
R8136:Sdk2	UTSW	11	113851713	missense	probably damaging	1.00
R8151:Sdk2	UTSW	11	113872857	missense	possibly damaging	0.84
R8394:Sdk2	UTSW	11	113838716	missense	probably benign
R8715:Sdk2	UTSW	11	113780902	missense	probably damaging	1.00
R8774:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8774-TAIL:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8804:Sdk2	UTSW	11	113873152	nonsense	probably null
R9136:Sdk2	UTSW	11	113806377	missense	probably damaging	1.00
R9147:Sdk2	UTSW	11	113823400	missense	probably benign	0.18
R9300:Sdk2	UTSW	11	113825030	missense	possibly damaging	0.63
R9354:Sdk2	UTSW	11	113834931	missense	probably benign	0.00
R9450:Sdk2	UTSW	11	113806279	missense	probably benign
R9462:Sdk2	UTSW	11	113869918	missense	possibly damaging	0.56
R9616:Sdk2	UTSW	11	113800235	missense	probably benign	0.05
R9678:Sdk2	UTSW	11	113794963	nonsense	probably null
RF002:Sdk2	UTSW	11	113885252	missense	probably benign	0.00
V1662:Sdk2	UTSW	11	113834908	missense	probably damaging	1.00
Z1176:Sdk2	UTSW	11	113839322	missense	probably benign	0.41
Z1176:Sdk2	UTSW	11	113851836	missense	probably damaging	0.97
Z1177:Sdk2	UTSW	11	113838659	missense	probably damaging	0.99
Z1177:Sdk2	UTSW	11	113839320	missense	probably damaging	1.00
Z1177:Sdk2	UTSW	11	113859956	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACCCCAAGGATGTGAAGCCATTG -3'
(R):5'- GCCTTTGAGTCCTGACCTCACTAAC -3'

Sequencing Primer
(F):5'- TGAAGCCATTGCAGGTCAC -3'
(R):5'- ACTAACACCCCGATTCTCTCC -3'

Posted On

2013-06-11