Incidental Mutation 'R5792:Zfhx2'
ID447045
Institutional Source Beutler Lab
Gene Symbol Zfhx2
Ensembl Gene ENSMUSG00000040721
Gene Namezinc finger homeobox 2
Synonymszfh-5
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.458) question?
Stock #R5792 (G1)
Quality Score159
Status Validated
Chromosome14
Chromosomal Location55060262-55092324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55066846 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1227 (E1227G)
Ref Sequence ENSEMBL: ENSMUSP00000045156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036328] [ENSMUST00000183822] [ENSMUST00000185121]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036328
AA Change: E1227G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045156
Gene: ENSMUSG00000040721
AA Change: E1227G

DomainStartEndE-ValueType
low complexity region 22 42 N/A INTRINSIC
ZnF_C2H2 230 252 1.43e1 SMART
low complexity region 333 345 N/A INTRINSIC
low complexity region 428 439 N/A INTRINSIC
ZnF_C2H2 446 469 8.94e-3 SMART
ZnF_U1 498 532 6.98e-1 SMART
ZnF_C2H2 501 525 3.21e-4 SMART
ZnF_U1 560 594 1.36e0 SMART
ZnF_C2H2 563 587 3.29e-1 SMART
low complexity region 597 623 N/A INTRINSIC
ZnF_C2H2 752 776 6.4e0 SMART
ZnF_C2H2 815 839 2.02e-1 SMART
ZnF_U1 861 895 1.78e1 SMART
ZnF_C2H2 864 888 5.34e-1 SMART
ZnF_C2H2 974 997 1.51e1 SMART
ZnF_C2H2 1003 1026 1.51e0 SMART
low complexity region 1087 1103 N/A INTRINSIC
low complexity region 1106 1126 N/A INTRINSIC
ZnF_U1 1182 1216 3.42e0 SMART
ZnF_C2H2 1185 1209 8.22e-2 SMART
ZnF_U1 1239 1273 3.73e0 SMART
ZnF_C2H2 1242 1266 6.67e-2 SMART
low complexity region 1277 1304 N/A INTRINSIC
low complexity region 1314 1326 N/A INTRINSIC
low complexity region 1332 1346 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
low complexity region 1379 1400 N/A INTRINSIC
low complexity region 1457 1465 N/A INTRINSIC
ZnF_C2H2 1474 1497 5.34e0 SMART
low complexity region 1522 1531 N/A INTRINSIC
low complexity region 1542 1554 N/A INTRINSIC
low complexity region 1562 1583 N/A INTRINSIC
HOX 1589 1651 1.97e-16 SMART
low complexity region 1656 1665 N/A INTRINSIC
coiled coil region 1693 1723 N/A INTRINSIC
ZnF_C2H2 1761 1783 2.53e-2 SMART
low complexity region 1837 1847 N/A INTRINSIC
HOX 1851 1913 2.34e-18 SMART
low complexity region 1984 1995 N/A INTRINSIC
low complexity region 2001 2051 N/A INTRINSIC
HOX 2058 2120 1.52e-17 SMART
ZnF_U1 2136 2170 1.09e1 SMART
ZnF_C2H2 2139 2163 5.4e1 SMART
low complexity region 2328 2354 N/A INTRINSIC
low complexity region 2385 2426 N/A INTRINSIC
ZnF_U1 2482 2516 8.31e-1 SMART
ZnF_C2H2 2485 2509 9.46e0 SMART
low complexity region 2523 2538 N/A INTRINSIC
low complexity region 2553 2562 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176665
SMART Domains Protein: ENSMUSP00000134955
Gene: ENSMUSG00000040721

DomainStartEndE-ValueType
ZnF_C2H2 13 37 5.34e-1 SMART
ZnF_C2H2 133 156 1.51e1 SMART
ZnF_C2H2 162 185 1.51e0 SMART
low complexity region 246 262 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
ZnF_C2H2 344 368 8.22e-2 SMART
ZnF_C2H2 401 425 6.67e-2 SMART
low complexity region 436 463 N/A INTRINSIC
low complexity region 473 485 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
low complexity region 538 559 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183822
SMART Domains Protein: ENSMUSP00000140371
Gene: ENSMUSG00000045691

DomainStartEndE-ValueType
PDB:2JMU|A 5 64 3e-23 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185121
Meta Mutation Damage Score 0.1168 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (56/59)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,521 I296F possibly damaging Het
Adamts19 C T 18: 58,837,512 T56M possibly damaging Het
Armc4 T C 18: 7,217,965 N583S probably benign Het
Axdnd1 T G 1: 156,341,889 E802D probably damaging Het
Birc6 T C 17: 74,631,053 V2630A probably benign Het
Capn5 A T 7: 98,131,195 F323I probably benign Het
Cdc25b A G 2: 131,191,759 E206G probably damaging Het
Cmah T G 13: 24,456,915 N382K probably benign Het
Col11a1 A T 3: 114,131,593 D25V probably damaging Het
Cyp2d41-ps G T 15: 82,779,220 noncoding transcript Het
Cyp3a59 A G 5: 146,099,851 K288E possibly damaging Het
Cyr61 T C 3: 145,648,658 D166G probably benign Het
Dclre1a A C 19: 56,529,590 I1019S probably damaging Het
Fat2 G T 11: 55,262,325 A3687D possibly damaging Het
Flg2 T A 3: 93,203,497 V944E unknown Het
Galntl5 T C 5: 25,198,463 V177A possibly damaging Het
Gm12695 T C 4: 96,728,283 T438A probably benign Het
Gm14295 A T 2: 176,811,014 N766Y probably benign Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm2431 C T 7: 142,258,332 G8E unknown Het
Gm5435 T A 12: 82,495,426 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grip1 T C 10: 119,985,480 I350T probably benign Het
Guf1 T A 5: 69,560,486 F196I probably damaging Het
Kcng4 G T 8: 119,626,279 D297E probably damaging Het
Khdrbs2 G A 1: 32,472,692 R246Q probably damaging Het
Layn T C 9: 51,068,161 E148G probably damaging Het
Lrig3 T A 10: 126,009,919 V739E probably damaging Het
Lyg1 A G 1: 37,947,267 W129R probably benign Het
Nup210l C T 3: 90,199,857 T1567I probably damaging Het
Nus1 T A 10: 52,429,256 L12* probably null Het
Olfr2 A T 7: 107,001,443 V139D possibly damaging Het
Olfr354 A G 2: 36,907,101 I52V probably benign Het
Otop1 A G 5: 38,297,916 N218S probably benign Het
Pcif1 T A 2: 164,885,379 N90K probably damaging Het
Phf2 T C 13: 48,820,042 probably null Het
Piezo2 T A 18: 63,146,856 I215F probably damaging Het
Pitpnm2 G T 5: 124,130,321 C553* probably null Het
Prdm1 A G 10: 44,450,228 V115A probably damaging Het
Prkdc A G 16: 15,816,752 D3587G probably damaging Het
Sez6l A T 5: 112,422,024 Y883* probably null Het
Sh3rf2 A C 18: 42,111,138 H223P probably damaging Het
Slco1a5 C T 6: 142,242,113 C500Y probably damaging Het
Slf1 T A 13: 77,066,737 H610L probably benign Het
Syn3 T C 10: 86,294,628 *244W probably null Het
Sytl2 A T 7: 90,375,689 D295V probably damaging Het
Tnfrsf1a T A 6: 125,358,077 C44S probably damaging Het
Ttc6 T G 12: 57,673,204 L854V possibly damaging Het
Ttn T C 2: 76,766,258 I18358V probably benign Het
Vmn2r108 A G 17: 20,463,136 V602A probably damaging Het
Zap70 A G 1: 36,779,009 probably benign Het
Znhit3 G A 11: 84,916,084 probably null Het
Zpbp2 A G 11: 98,551,410 probably benign Het
Other mutations in Zfhx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Zfhx2 APN 14 55066565 missense possibly damaging 0.93
IGL00164:Zfhx2 APN 14 55065026 missense possibly damaging 0.73
IGL00235:Zfhx2 APN 14 55063257 missense probably benign 0.11
IGL00925:Zfhx2 APN 14 55073061 missense probably benign 0.06
IGL01025:Zfhx2 APN 14 55064260 missense probably damaging 1.00
IGL01061:Zfhx2 APN 14 55073882 missense possibly damaging 0.96
IGL01486:Zfhx2 APN 14 55067090 missense probably damaging 1.00
IGL01875:Zfhx2 APN 14 55063915 missense unknown
IGL01990:Zfhx2 APN 14 55073590 missense probably damaging 0.99
IGL02097:Zfhx2 APN 14 55062894 missense probably damaging 1.00
IGL02269:Zfhx2 APN 14 55071936 missense probably benign 0.00
IGL02488:Zfhx2 APN 14 55065103 missense possibly damaging 0.72
IGL02624:Zfhx2 APN 14 55066628 missense probably benign 0.06
IGL03087:Zfhx2 APN 14 55072845 missense possibly damaging 0.85
PIT4403001:Zfhx2 UTSW 14 55074980 missense probably benign
R0148:Zfhx2 UTSW 14 55072897 missense possibly damaging 0.86
R0323:Zfhx2 UTSW 14 55065979 missense possibly damaging 0.73
R0328:Zfhx2 UTSW 14 55071988 missense probably benign
R0348:Zfhx2 UTSW 14 55063508 missense probably damaging 0.99
R0442:Zfhx2 UTSW 14 55066900 missense possibly damaging 0.53
R0533:Zfhx2 UTSW 14 55064090 missense probably benign 0.23
R0561:Zfhx2 UTSW 14 55065889 missense probably benign 0.01
R0627:Zfhx2 UTSW 14 55065327 missense probably benign
R0659:Zfhx2 UTSW 14 55073801 missense possibly damaging 0.73
R0675:Zfhx2 UTSW 14 55063163 missense probably damaging 0.99
R1301:Zfhx2 UTSW 14 55063397 missense probably benign 0.32
R1563:Zfhx2 UTSW 14 55065088 missense probably benign 0.33
R1607:Zfhx2 UTSW 14 55062985 missense probably damaging 1.00
R1694:Zfhx2 UTSW 14 55073944 missense possibly damaging 0.91
R1710:Zfhx2 UTSW 14 55065998 missense possibly damaging 0.70
R1773:Zfhx2 UTSW 14 55072891 missense possibly damaging 0.53
R1879:Zfhx2 UTSW 14 55065617 missense probably benign 0.32
R1879:Zfhx2 UTSW 14 55072749 missense possibly damaging 0.96
R1933:Zfhx2 UTSW 14 55075238 start gained probably benign
R1944:Zfhx2 UTSW 14 55074732 missense probably benign 0.18
R2888:Zfhx2 UTSW 14 55064803 missense possibly damaging 0.71
R2889:Zfhx2 UTSW 14 55064803 missense possibly damaging 0.71
R2915:Zfhx2 UTSW 14 55064557 missense probably damaging 0.98
R3971:Zfhx2 UTSW 14 55074475 missense probably benign 0.33
R4082:Zfhx2 UTSW 14 55065205 missense probably benign
R4134:Zfhx2 UTSW 14 55065143 missense possibly damaging 0.93
R4231:Zfhx2 UTSW 14 55073534 missense possibly damaging 0.73
R4675:Zfhx2 UTSW 14 55067221 missense probably benign 0.03
R4764:Zfhx2 UTSW 14 55066915 missense possibly damaging 0.96
R4866:Zfhx2 UTSW 14 55065536 missense possibly damaging 0.73
R4940:Zfhx2 UTSW 14 55066434 missense possibly damaging 0.53
R5125:Zfhx2 UTSW 14 55074775 missense probably benign 0.00
R5178:Zfhx2 UTSW 14 55074775 missense probably benign 0.00
R5554:Zfhx2 UTSW 14 55064317 missense probably damaging 1.00
R5689:Zfhx2 UTSW 14 55073903 missense possibly damaging 0.53
R5768:Zfhx2 UTSW 14 55074365 missense probably benign
R5834:Zfhx2 UTSW 14 55073330 nonsense probably null
R5895:Zfhx2 UTSW 14 55065891 missense probably benign
R5999:Zfhx2 UTSW 14 55074005 missense probably benign
R6025:Zfhx2 UTSW 14 55065208 missense probably benign 0.00
R6106:Zfhx2 UTSW 14 55068310 critical splice acceptor site probably null
R6135:Zfhx2 UTSW 14 55074196 missense possibly damaging 0.85
R6186:Zfhx2 UTSW 14 55063160 missense probably damaging 0.99
R6379:Zfhx2 UTSW 14 55074338 missense probably benign
R6725:Zfhx2 UTSW 14 55064082 nonsense probably null
R7089:Zfhx2 UTSW 14 55065772 missense probably benign 0.33
R7383:Zfhx2 UTSW 14 55068253 missense probably benign 0.00
R7470:Zfhx2 UTSW 14 55066750 missense possibly damaging 0.52
R7606:Zfhx2 UTSW 14 55066663 missense probably benign 0.12
R7607:Zfhx2 UTSW 14 55066231 missense possibly damaging 0.86
R7698:Zfhx2 UTSW 14 55062849 missense probably benign 0.00
R7730:Zfhx2 UTSW 14 55066900 missense possibly damaging 0.53
R8142:Zfhx2 UTSW 14 55073438 missense possibly damaging 0.86
R8188:Zfhx2 UTSW 14 55064441 missense probably benign 0.18
R8212:Zfhx2 UTSW 14 55072916 missense possibly damaging 0.70
R8264:Zfhx2 UTSW 14 55065512 missense possibly damaging 0.53
R8331:Zfhx2 UTSW 14 55071987 missense probably benign 0.00
R8369:Zfhx2 UTSW 14 55066744 missense probably benign 0.05
R8371:Zfhx2 UTSW 14 55064092 missense probably damaging 0.99
R8383:Zfhx2 UTSW 14 55074071 missense possibly damaging 0.73
R8415:Zfhx2 UTSW 14 55070622 missense probably benign
R8441:Zfhx2 UTSW 14 55066528 missense possibly damaging 0.96
R8466:Zfhx2 UTSW 14 55072896 missense possibly damaging 0.53
R8504:Zfhx2 UTSW 14 55065786 missense probably benign 0.00
X0065:Zfhx2 UTSW 14 55066960 missense probably benign 0.33
Z1088:Zfhx2 UTSW 14 55074180 missense possibly damaging 0.73
Z1177:Zfhx2 UTSW 14 55065920 missense probably benign 0.40
Z1177:Zfhx2 UTSW 14 55066982 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GTCAGGGCCTTTCTTCTCAG -3'
(R):5'- CAAACTTTGCCCTGGACAAG -3'

Sequencing Primer
(F):5'- AGGGCCTTTCTTCTCAGTACCTG -3'
(R):5'- GCCCTGGACAAGTTTCTTGAC -3'
Posted On2016-12-15