Incidental Mutation 'R5792:Sh3rf2'
ID447050
Institutional Source Beutler Lab
Gene Symbol Sh3rf2
Ensembl Gene ENSMUSG00000057719
Gene NameSH3 domain containing ring finger 2
Synonyms9130023G24Rik, RNF158
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5792 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location42053667-42158960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 42111138 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 223 (H223P)
Ref Sequence ENSEMBL: ENSMUSP00000074247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072008] [ENSMUST00000074679]
Predicted Effect probably damaging
Transcript: ENSMUST00000072008
AA Change: H255P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071896
Gene: ENSMUSG00000057719
AA Change: H255P

DomainStartEndE-ValueType
RING 12 52 7.38e-8 SMART
low complexity region 63 73 N/A INTRINSIC
SH3 128 183 4.66e-17 SMART
SH3 190 251 1.45e-13 SMART
low complexity region 357 366 N/A INTRINSIC
SH3 385 442 3.27e-12 SMART
low complexity region 500 514 N/A INTRINSIC
low complexity region 614 631 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074679
AA Change: H223P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074247
Gene: ENSMUSG00000057719
AA Change: H223P

DomainStartEndE-ValueType
RING 12 52 7.38e-8 SMART
low complexity region 63 73 N/A INTRINSIC
SH3 128 183 4.66e-17 SMART
low complexity region 325 334 N/A INTRINSIC
SH3 353 410 3.27e-12 SMART
low complexity region 468 482 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
Meta Mutation Damage Score 0.1190 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (56/59)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,521 I296F possibly damaging Het
Adamts19 C T 18: 58,837,512 T56M possibly damaging Het
Armc4 T C 18: 7,217,965 N583S probably benign Het
Axdnd1 T G 1: 156,341,889 E802D probably damaging Het
Birc6 T C 17: 74,631,053 V2630A probably benign Het
Capn5 A T 7: 98,131,195 F323I probably benign Het
Cdc25b A G 2: 131,191,759 E206G probably damaging Het
Cmah T G 13: 24,456,915 N382K probably benign Het
Col11a1 A T 3: 114,131,593 D25V probably damaging Het
Cyp2d41-ps G T 15: 82,779,220 noncoding transcript Het
Cyp3a59 A G 5: 146,099,851 K288E possibly damaging Het
Cyr61 T C 3: 145,648,658 D166G probably benign Het
Dclre1a A C 19: 56,529,590 I1019S probably damaging Het
Fat2 G T 11: 55,262,325 A3687D possibly damaging Het
Flg2 T A 3: 93,203,497 V944E unknown Het
Galntl5 T C 5: 25,198,463 V177A possibly damaging Het
Gm12695 T C 4: 96,728,283 T438A probably benign Het
Gm14295 A T 2: 176,811,014 N766Y probably benign Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm2431 C T 7: 142,258,332 G8E unknown Het
Gm5435 T A 12: 82,495,426 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grip1 T C 10: 119,985,480 I350T probably benign Het
Guf1 T A 5: 69,560,486 F196I probably damaging Het
Kcng4 G T 8: 119,626,279 D297E probably damaging Het
Khdrbs2 G A 1: 32,472,692 R246Q probably damaging Het
Layn T C 9: 51,068,161 E148G probably damaging Het
Lrig3 T A 10: 126,009,919 V739E probably damaging Het
Lyg1 A G 1: 37,947,267 W129R probably benign Het
Nup210l C T 3: 90,199,857 T1567I probably damaging Het
Nus1 T A 10: 52,429,256 L12* probably null Het
Olfr2 A T 7: 107,001,443 V139D possibly damaging Het
Olfr354 A G 2: 36,907,101 I52V probably benign Het
Otop1 A G 5: 38,297,916 N218S probably benign Het
Pcif1 T A 2: 164,885,379 N90K probably damaging Het
Phf2 T C 13: 48,820,042 probably null Het
Piezo2 T A 18: 63,146,856 I215F probably damaging Het
Pitpnm2 G T 5: 124,130,321 C553* probably null Het
Prdm1 A G 10: 44,450,228 V115A probably damaging Het
Prkdc A G 16: 15,816,752 D3587G probably damaging Het
Sez6l A T 5: 112,422,024 Y883* probably null Het
Slco1a5 C T 6: 142,242,113 C500Y probably damaging Het
Slf1 T A 13: 77,066,737 H610L probably benign Het
Syn3 T C 10: 86,294,628 *244W probably null Het
Sytl2 A T 7: 90,375,689 D295V probably damaging Het
Tnfrsf1a T A 6: 125,358,077 C44S probably damaging Het
Ttc6 T G 12: 57,673,204 L854V possibly damaging Het
Ttn T C 2: 76,766,258 I18358V probably benign Het
Vmn2r108 A G 17: 20,463,136 V602A probably damaging Het
Zap70 A G 1: 36,779,009 probably benign Het
Zfhx2 T C 14: 55,066,846 E1227G possibly damaging Het
Znhit3 G A 11: 84,916,084 probably null Het
Zpbp2 A G 11: 98,551,410 probably benign Het
Other mutations in Sh3rf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Sh3rf2 APN 18 42111218 missense probably benign 0.00
IGL01012:Sh3rf2 APN 18 42054192 missense possibly damaging 0.50
IGL01286:Sh3rf2 APN 18 42139611 critical splice donor site probably null
IGL02369:Sh3rf2 APN 18 42156157 nonsense probably null
IGL02563:Sh3rf2 APN 18 42156142 missense probably damaging 0.99
BB004:Sh3rf2 UTSW 18 42111422 missense probably benign
BB014:Sh3rf2 UTSW 18 42111422 missense probably benign
PIT4445001:Sh3rf2 UTSW 18 42153164 missense probably benign 0.00
R0141:Sh3rf2 UTSW 18 42156057 missense probably benign 0.02
R0270:Sh3rf2 UTSW 18 42104081 missense probably damaging 0.99
R1447:Sh3rf2 UTSW 18 42101671 missense probably benign 0.00
R1491:Sh3rf2 UTSW 18 42053939 missense probably damaging 0.99
R1539:Sh3rf2 UTSW 18 42149822 missense probably damaging 1.00
R1595:Sh3rf2 UTSW 18 42111288 missense probably damaging 1.00
R1749:Sh3rf2 UTSW 18 42153294 missense probably damaging 1.00
R1864:Sh3rf2 UTSW 18 42053981 missense probably damaging 0.99
R1942:Sh3rf2 UTSW 18 42149624 missense probably damaging 1.00
R1998:Sh3rf2 UTSW 18 42141083 missense probably damaging 0.99
R2331:Sh3rf2 UTSW 18 42053863 missense probably benign 0.04
R2680:Sh3rf2 UTSW 18 42101650 missense probably damaging 0.98
R2938:Sh3rf2 UTSW 18 42149724 missense probably benign 0.09
R2940:Sh3rf2 UTSW 18 42111440 critical splice donor site probably null
R3753:Sh3rf2 UTSW 18 42111308 missense probably damaging 1.00
R3861:Sh3rf2 UTSW 18 42153319 missense probably damaging 1.00
R4322:Sh3rf2 UTSW 18 42111399 missense probably damaging 1.00
R5076:Sh3rf2 UTSW 18 42053924 missense probably damaging 1.00
R5169:Sh3rf2 UTSW 18 42153061 missense probably benign 0.00
R5228:Sh3rf2 UTSW 18 42153181 missense possibly damaging 0.69
R5437:Sh3rf2 UTSW 18 42141014 missense probably benign 0.44
R5820:Sh3rf2 UTSW 18 42141047 missense possibly damaging 0.94
R6159:Sh3rf2 UTSW 18 42156135 missense probably damaging 0.96
R6366:Sh3rf2 UTSW 18 42153065 missense probably benign 0.00
R6640:Sh3rf2 UTSW 18 42101640 missense probably damaging 1.00
R6897:Sh3rf2 UTSW 18 42101605 missense possibly damaging 0.91
R6995:Sh3rf2 UTSW 18 42101541 missense probably damaging 1.00
R7097:Sh3rf2 UTSW 18 42104162 splice site probably null
R7122:Sh3rf2 UTSW 18 42104162 splice site probably null
R7432:Sh3rf2 UTSW 18 42054026 missense probably damaging 0.99
R7444:Sh3rf2 UTSW 18 42101539 missense probably damaging 1.00
R7654:Sh3rf2 UTSW 18 42104108 missense probably damaging 1.00
R7703:Sh3rf2 UTSW 18 42156136 missense probably benign 0.04
R7732:Sh3rf2 UTSW 18 42101688 missense probably damaging 1.00
R7835:Sh3rf2 UTSW 18 42111170 missense probably benign 0.25
R7927:Sh3rf2 UTSW 18 42111422 missense probably benign
R8053:Sh3rf2 UTSW 18 42153022 missense probably damaging 1.00
R8144:Sh3rf2 UTSW 18 42141059 missense probably benign 0.01
R8343:Sh3rf2 UTSW 18 42111428 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTCCACTCTGTCTCAAACAC -3'
(R):5'- TGGCCTTCAGGAGAATGGAC -3'

Sequencing Primer
(F):5'- ACTCTGTCTCAAACACCAAATTATG -3'
(R):5'- CCTTCAGGAGAATGGACTGTAC -3'
Posted On2016-12-15