Mutagenetix > Incidental Mutations

Incidental Mutation 'R5792:Dclre1a'

447053

Institutional Source

Beutler Lab

Gene Symbol

Dclre1a

Ensembl Gene

ENSMUSG00000025077

Gene Name

DNA cross-link repair 1A

Synonyms

2810043H12Rik, SMN1a, SNM1, mSNM1

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5792 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56529167-56548222 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 56529590 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 1019 (I1019S)

Ref Sequence

ENSEMBL: ENSMUSP00000138290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000182276] [ENSMUST00000183143]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182058

Predicted Effect

probably damaging
Transcript: ENSMUST00000182276
AA Change: I1019S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138290
Gene: ENSMUSG00000025077
AA Change: I1019S

Domain	Start	End	E-Value	Type
low complexity region	90	110	N/A	INTRINSIC
low complexity region	211	220	N/A	INTRINSIC
low complexity region	546	560	N/A	INTRINSIC
Lactamase_B	705	853	7.86e-1	SMART
Pfam:DRMBL	921	1027	1e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000183143

SMART Domains

Protein: ENSMUSP00000138537
Gene: ENSMUSG00000025077

Domain	Start	End	E-Value	Type
low complexity region	90	110	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183216

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

95% (56/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein that is involved in the repair of DNA interstrand cross-links. DNA cross-links suppress transcription, replication, and DNA segregation. The encoded protein is a regulator of the mitotic cell cycle checkpoint. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but exhibit increased sensitivity to the DNA interstrand cross-linking agent mitomycin C. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,521	I296F	possibly damaging	Het
Adamts19	C	T	18: 58,837,512	T56M	possibly damaging	Het
Armc4	T	C	18: 7,217,965	N583S	probably benign	Het
Axdnd1	T	G	1: 156,341,889	E802D	probably damaging	Het
Birc6	T	C	17: 74,631,053	V2630A	probably benign	Het
Capn5	A	T	7: 98,131,195	F323I	probably benign	Het
Cdc25b	A	G	2: 131,191,759	E206G	probably damaging	Het
Cmah	T	G	13: 24,456,915	N382K	probably benign	Het
Col11a1	A	T	3: 114,131,593	D25V	probably damaging	Het
Cyp2d41-ps	G	T	15: 82,779,220		noncoding transcript	Het
Cyp3a59	A	G	5: 146,099,851	K288E	possibly damaging	Het
Cyr61	T	C	3: 145,648,658	D166G	probably benign	Het
Fat2	G	T	11: 55,262,325	A3687D	possibly damaging	Het
Flg2	T	A	3: 93,203,497	V944E	unknown	Het
Galntl5	T	C	5: 25,198,463	V177A	possibly damaging	Het
Gm12695	T	C	4: 96,728,283	T438A	probably benign	Het
Gm14295	A	T	2: 176,811,014	N766Y	probably benign	Het
Gm15433	T	A	1: 84,964,112		noncoding transcript	Het
Gm2431	C	T	7: 142,258,332	G8E	unknown	Het
Gm5435	T	A	12: 82,495,426		noncoding transcript	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Grip1	T	C	10: 119,985,480	I350T	probably benign	Het
Guf1	T	A	5: 69,560,486	F196I	probably damaging	Het
Kcng4	G	T	8: 119,626,279	D297E	probably damaging	Het
Khdrbs2	G	A	1: 32,472,692	R246Q	probably damaging	Het
Layn	T	C	9: 51,068,161	E148G	probably damaging	Het
Lrig3	T	A	10: 126,009,919	V739E	probably damaging	Het
Lyg1	A	G	1: 37,947,267	W129R	probably benign	Het
Nup210l	C	T	3: 90,199,857	T1567I	probably damaging	Het
Nus1	T	A	10: 52,429,256	L12*	probably null	Het
Olfr2	A	T	7: 107,001,443	V139D	possibly damaging	Het
Olfr354	A	G	2: 36,907,101	I52V	probably benign	Het
Otop1	A	G	5: 38,297,916	N218S	probably benign	Het
Pcif1	T	A	2: 164,885,379	N90K	probably damaging	Het
Phf2	T	C	13: 48,820,042		probably null	Het
Piezo2	T	A	18: 63,146,856	I215F	probably damaging	Het
Pitpnm2	G	T	5: 124,130,321	C553*	probably null	Het
Prdm1	A	G	10: 44,450,228	V115A	probably damaging	Het
Prkdc	A	G	16: 15,816,752	D3587G	probably damaging	Het
Sez6l	A	T	5: 112,422,024	Y883*	probably null	Het
Sh3rf2	A	C	18: 42,111,138	H223P	probably damaging	Het
Slco1a5	C	T	6: 142,242,113	C500Y	probably damaging	Het
Slf1	T	A	13: 77,066,737	H610L	probably benign	Het
Syn3	T	C	10: 86,294,628	*244W	probably null	Het
Sytl2	A	T	7: 90,375,689	D295V	probably damaging	Het
Tnfrsf1a	T	A	6: 125,358,077	C44S	probably damaging	Het
Ttc6	T	G	12: 57,673,204	L854V	possibly damaging	Het
Ttn	T	C	2: 76,766,258	I18358V	probably benign	Het
Vmn2r108	A	G	17: 20,463,136	V602A	probably damaging	Het
Zap70	A	G	1: 36,779,009		probably benign	Het
Zfhx2	T	C	14: 55,066,846	E1227G	possibly damaging	Het
Znhit3	G	A	11: 84,916,084		probably null	Het
Zpbp2	A	G	11: 98,551,410		probably benign	Het

Other mutations in Dclre1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01655:Dclre1a	APN	19	56547057	missense	probably damaging	1.00
IGL02113:Dclre1a	APN	19	56541532	missense	probably damaging	0.98
IGL02264:Dclre1a	APN	19	56544293	missense	possibly damaging	0.93
IGL03303:Dclre1a	APN	19	56546766	missense	possibly damaging	0.85
Gof	UTSW	19	56542709	missense	probably damaging	1.00
Hoopla	UTSW	19	56546635	critical splice donor site	probably null
FR4589:Dclre1a	UTSW	19	56544123	utr 3 prime	probably benign
PIT4377001:Dclre1a	UTSW	19	56544405	missense	probably benign	0.05
R0081:Dclre1a	UTSW	19	56542707	missense	probably damaging	1.00
R0355:Dclre1a	UTSW	19	56546635	critical splice donor site	probably null
R0422:Dclre1a	UTSW	19	56544135	nonsense	probably null
R0486:Dclre1a	UTSW	19	56541490	splice site	probably benign
R0619:Dclre1a	UTSW	19	56545409	missense	probably benign	0.00
R0639:Dclre1a	UTSW	19	56538440	missense	probably damaging	1.00
R1221:Dclre1a	UTSW	19	56531268	missense	possibly damaging	0.69
R1352:Dclre1a	UTSW	19	56545163	missense	probably damaging	1.00
R1824:Dclre1a	UTSW	19	56546718	splice site	probably null
R1833:Dclre1a	UTSW	19	56541500	splice site	probably null
R3851:Dclre1a	UTSW	19	56541507	missense	probably damaging	1.00
R3889:Dclre1a	UTSW	19	56545320	missense	probably benign	0.00
R4373:Dclre1a	UTSW	19	56545442	missense	probably benign	0.04
R5277:Dclre1a	UTSW	19	56544732	missense	possibly damaging	0.78
R5747:Dclre1a	UTSW	19	56541532	missense	probably damaging	0.98
R5892:Dclre1a	UTSW	19	56547140	missense	probably benign	0.29
R5993:Dclre1a	UTSW	19	56542737	missense	probably damaging	1.00
R6368:Dclre1a	UTSW	19	56546791	missense	probably benign	0.02
R6706:Dclre1a	UTSW	19	56545069	missense	probably benign	0.11
R6944:Dclre1a	UTSW	19	56545019	missense	possibly damaging	0.90
R6960:Dclre1a	UTSW	19	56542709	missense	probably damaging	1.00
R7023:Dclre1a	UTSW	19	56540206	missense	probably damaging	0.99
R7213:Dclre1a	UTSW	19	56529635	missense	probably damaging	1.00
R7355:Dclre1a	UTSW	19	56547135	missense	possibly damaging	0.53
R7413:Dclre1a	UTSW	19	56542650	missense	probably damaging	1.00
R7577:Dclre1a	UTSW	19	56529533	missense	probably damaging	1.00
R7840:Dclre1a	UTSW	19	56531252	missense	probably damaging	1.00
R8270:Dclre1a	UTSW	19	56544950	missense	possibly damaging	0.61
R8303:Dclre1a	UTSW	19	56542689	missense	probably damaging	1.00
RF031:Dclre1a	UTSW	19	56544132	utr 3 prime	probably benign
RF046:Dclre1a	UTSW	19	56544132	utr 3 prime	probably benign

Predicted Primers

PCR Primer
(F):5'- TATCACTGTTCAAAGCGAGGG -3'
(R):5'- GTTTTATTGTCTAAAGCACTGGAGG -3'

Sequencing Primer
(F):5'- GCAGTCCTGAGGCTGTTC -3'
(R):5'- GAAAATAACCTCTTCCCTCTG -3'

Posted On

2016-12-15