Incidental Mutation 'R5793:Padi2'
ID447065
Institutional Source Beutler Lab
Gene Symbol Padi2
Ensembl Gene ENSMUSG00000028927
Gene Namepeptidyl arginine deiminase, type II
SynonymsPAD type II, Pdi, Pdi2
MMRRC Submission 043208-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R5793 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location140906344-140952586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140933190 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 327 (L327P)
Ref Sequence ENSEMBL: ENSMUSP00000030765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030765]
Predicted Effect probably benign
Transcript: ENSMUST00000030765
AA Change: L327P

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000030765
Gene: ENSMUSG00000028927
AA Change: L327P

DomainStartEndE-ValueType
Pfam:PAD_N 9 122 1.7e-36 PFAM
Pfam:PAD_M 124 282 4e-71 PFAM
Pfam:PAD 292 670 3.8e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148160
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type II enzyme is the most widely expressed family member. Known substrates for this enzyme include myelin basic protein in the central nervous system and vimentin in skeletal muscle and macrophages. This enzyme is thought to play a role in the onset and progression of neurodegenerative human disorders, including Alzheimer disease and multiple sclerosis, and it has also been implicated in glaucoma pathogenesis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired ATP- or calcium ionophore ionomycin-induced citrullination of mast cells or of proteins following induction of EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12 C A 11: 70,243,053 R522L probably benign Het
Arfgef1 A T 1: 10,209,528 D271E probably benign Het
Arg1 C T 10: 24,920,642 V96M probably benign Het
Arhgap8 T A 15: 84,772,022 M408K probably benign Het
Axin1 T C 17: 26,143,308 S209P probably damaging Het
B4galnt3 A G 6: 120,208,904 probably null Het
BC025446 T C 15: 75,221,644 probably benign Het
BC067074 G T 13: 113,321,022 V1201L possibly damaging Het
Cdh23 T A 10: 60,306,128 D3058V probably damaging Het
Chd9 A G 8: 91,001,756 T794A probably damaging Het
Ckap5 C T 2: 91,619,835 T1891I possibly damaging Het
Dzank1 T C 2: 144,506,224 I207M probably benign Het
Fkbp9 G A 6: 56,873,513 probably null Het
Gm4781 T A 10: 100,396,667 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtpbp6 G A 5: 110,107,228 L33F probably benign Het
Hsd11b1 A C 1: 193,242,184 F27V probably damaging Het
Ift172 A T 5: 31,276,948 I482N possibly damaging Het
Kcnma1 C T 14: 23,309,035 probably null Het
Myh9 T C 15: 77,768,877 Q1420R probably benign Het
Ncam2 G A 16: 81,576,103 V569I possibly damaging Het
Nsd1 T C 13: 55,248,006 V1140A probably benign Het
Ogdhl T A 14: 32,332,773 L226Q probably damaging Het
Olfr645 T C 7: 104,085,030 T17A probably benign Het
Orc2 T C 1: 58,497,388 M1V probably null Het
Palb2 T C 7: 122,127,637 N337D probably benign Het
Pard3b A T 1: 61,767,973 H49L probably damaging Het
Pigz T C 16: 31,945,467 S448P probably benign Het
Ppfia4 A G 1: 134,312,106 V911A probably damaging Het
Qser1 T C 2: 104,762,860 Y1604C probably damaging Het
Rpgrip1l A G 8: 91,260,772 S886P probably benign Het
Sdk2 T C 11: 113,868,952 I408V possibly damaging Het
Sema7a A T 9: 57,960,257 R431W probably damaging Het
Slc22a30 T A 19: 8,336,819 Y501F possibly damaging Het
Slitrk5 T A 14: 111,679,913 V323D probably damaging Het
Snap47 C T 11: 59,438,192 E95K probably damaging Het
Tbc1d9 A T 8: 83,271,440 I1209F probably damaging Het
Tek T A 4: 94,820,096 M297K probably benign Het
Tmem132e T A 11: 82,444,858 I922N probably damaging Het
Tmx2 T C 2: 84,676,157 R64G probably damaging Het
Trim68 A T 7: 102,684,353 S41T possibly damaging Het
Tsga10 A T 1: 37,835,459 M115K probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r84 C T 10: 130,385,885 C822Y probably damaging Het
Wdr72 C T 9: 74,210,343 A779V probably benign Het
Zfp580 A T 7: 5,052,892 probably benign Het
Zfp772 G A 7: 7,204,284 T136I probably benign Het
Other mutations in Padi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Padi2 APN 4 140917637 missense probably benign 0.27
IGL01374:Padi2 APN 4 140933185 missense probably damaging 1.00
IGL01608:Padi2 APN 4 140932230 missense probably damaging 1.00
IGL02085:Padi2 APN 4 140927157 nonsense probably null
IGL02593:Padi2 APN 4 140949842 missense probably damaging 1.00
IGL02668:Padi2 APN 4 140949880 missense probably benign 0.02
IGL03341:Padi2 APN 4 140927113 missense probably benign 0.06
R0116:Padi2 UTSW 4 140926239 missense probably benign 0.00
R2045:Padi2 UTSW 4 140937930 missense probably damaging 1.00
R2079:Padi2 UTSW 4 140933196 missense probably damaging 1.00
R3022:Padi2 UTSW 4 140937988 missense possibly damaging 0.79
R3079:Padi2 UTSW 4 140949878 missense probably damaging 0.99
R3780:Padi2 UTSW 4 140917737 missense probably benign 0.00
R4250:Padi2 UTSW 4 140906546 missense probably damaging 0.97
R4276:Padi2 UTSW 4 140936548 missense possibly damaging 0.93
R4647:Padi2 UTSW 4 140944446 missense probably damaging 1.00
R5058:Padi2 UTSW 4 140932121 missense probably benign 0.00
R5452:Padi2 UTSW 4 140932071 missense probably benign 0.26
R5471:Padi2 UTSW 4 140933208 missense possibly damaging 0.90
R5489:Padi2 UTSW 4 140944488 missense probably damaging 0.99
R5519:Padi2 UTSW 4 140949222 missense probably damaging 1.00
R5666:Padi2 UTSW 4 140949231 missense possibly damaging 0.76
R5913:Padi2 UTSW 4 140917641 missense probably benign 0.00
R5929:Padi2 UTSW 4 140944537 critical splice donor site probably null
R5933:Padi2 UTSW 4 140917641 missense probably benign 0.00
R6478:Padi2 UTSW 4 140917637 missense probably benign 0.00
R6809:Padi2 UTSW 4 140946766 splice site probably null
R7075:Padi2 UTSW 4 140933217 missense probably damaging 0.96
R7313:Padi2 UTSW 4 140932768 missense probably damaging 0.99
R7380:Padi2 UTSW 4 140917686 nonsense probably null
R7391:Padi2 UTSW 4 140937955 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCACCCTGGATTATGACCC -3'
(R):5'- TGCTCTTGAGCAGACAGAACG -3'

Sequencing Primer
(F):5'- ACTTAGCGGCTATATGACCCG -3'
(R):5'- TCTTGAGCAGACAGAACGATCCAC -3'
Posted On2016-12-15