Incidental Mutation 'R5793:Zfp580'
ID447070
Institutional Source Beutler Lab
Gene Symbol Zfp580
Ensembl Gene ENSMUSG00000055633
Gene Namezinc finger protein 580
Synonyms
MMRRC Submission 043208-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5793 (G1)
Quality Score183
Status Not validated
Chromosome7
Chromosomal Location5051538-5053723 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 5052892 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045543] [ENSMUST00000069324] [ENSMUST00000108571] [ENSMUST00000207215] [ENSMUST00000207974] [ENSMUST00000208042] [ENSMUST00000208161] [ENSMUST00000208570] [ENSMUST00000208728]
Predicted Effect probably benign
Transcript: ENSMUST00000045543
SMART Domains Protein: ENSMUSP00000041033
Gene: ENSMUSG00000035228

DomainStartEndE-ValueType
coiled coil region 62 101 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000069324
AA Change: T26S
SMART Domains Protein: ENSMUSP00000065861
Gene: ENSMUSG00000055633
AA Change: T26S

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
ZnF_C2H2 92 114 3.39e-3 SMART
ZnF_C2H2 120 142 1.18e-2 SMART
ZnF_C2H2 150 172 1.04e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108571
SMART Domains Protein: ENSMUSP00000104211
Gene: ENSMUSG00000035228

DomainStartEndE-ValueType
Pfam:CCDC106 117 337 1.4e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145534
Predicted Effect probably benign
Transcript: ENSMUST00000207215
Predicted Effect probably benign
Transcript: ENSMUST00000207974
Predicted Effect probably benign
Transcript: ENSMUST00000208042
Predicted Effect probably benign
Transcript: ENSMUST00000208161
Predicted Effect unknown
Transcript: ENSMUST00000208570
AA Change: T84S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208606
Predicted Effect probably benign
Transcript: ENSMUST00000208728
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12 C A 11: 70,243,053 R522L probably benign Het
Arfgef1 A T 1: 10,209,528 D271E probably benign Het
Arg1 C T 10: 24,920,642 V96M probably benign Het
Arhgap8 T A 15: 84,772,022 M408K probably benign Het
Axin1 T C 17: 26,143,308 S209P probably damaging Het
B4galnt3 A G 6: 120,208,904 probably null Het
BC025446 T C 15: 75,221,644 probably benign Het
BC067074 G T 13: 113,321,022 V1201L possibly damaging Het
Cdh23 T A 10: 60,306,128 D3058V probably damaging Het
Chd9 A G 8: 91,001,756 T794A probably damaging Het
Ckap5 C T 2: 91,619,835 T1891I possibly damaging Het
Dzank1 T C 2: 144,506,224 I207M probably benign Het
Fkbp9 G A 6: 56,873,513 probably null Het
Gm4781 T A 10: 100,396,667 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtpbp6 G A 5: 110,107,228 L33F probably benign Het
Hsd11b1 A C 1: 193,242,184 F27V probably damaging Het
Ift172 A T 5: 31,276,948 I482N possibly damaging Het
Kcnma1 C T 14: 23,309,035 probably null Het
Myh9 T C 15: 77,768,877 Q1420R probably benign Het
Ncam2 G A 16: 81,576,103 V569I possibly damaging Het
Nsd1 T C 13: 55,248,006 V1140A probably benign Het
Ogdhl T A 14: 32,332,773 L226Q probably damaging Het
Olfr645 T C 7: 104,085,030 T17A probably benign Het
Orc2 T C 1: 58,497,388 M1V probably null Het
Padi2 T C 4: 140,933,190 L327P probably benign Het
Palb2 T C 7: 122,127,637 N337D probably benign Het
Pard3b A T 1: 61,767,973 H49L probably damaging Het
Pigz T C 16: 31,945,467 S448P probably benign Het
Ppfia4 A G 1: 134,312,106 V911A probably damaging Het
Qser1 T C 2: 104,762,860 Y1604C probably damaging Het
Rpgrip1l A G 8: 91,260,772 S886P probably benign Het
Sdk2 T C 11: 113,868,952 I408V possibly damaging Het
Sema7a A T 9: 57,960,257 R431W probably damaging Het
Slc22a30 T A 19: 8,336,819 Y501F possibly damaging Het
Slitrk5 T A 14: 111,679,913 V323D probably damaging Het
Snap47 C T 11: 59,438,192 E95K probably damaging Het
Tbc1d9 A T 8: 83,271,440 I1209F probably damaging Het
Tek T A 4: 94,820,096 M297K probably benign Het
Tmem132e T A 11: 82,444,858 I922N probably damaging Het
Tmx2 T C 2: 84,676,157 R64G probably damaging Het
Trim68 A T 7: 102,684,353 S41T possibly damaging Het
Tsga10 A T 1: 37,835,459 M115K probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r84 C T 10: 130,385,885 C822Y probably damaging Het
Wdr72 C T 9: 74,210,343 A779V probably benign Het
Zfp772 G A 7: 7,204,284 T136I probably benign Het
Other mutations in Zfp580
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Zfp580 APN 7 5053268 missense possibly damaging 0.64
R1580:Zfp580 UTSW 7 5053285 missense probably damaging 1.00
R2120:Zfp580 UTSW 7 5053009 missense probably damaging 0.99
R2167:Zfp580 UTSW 7 5053064 missense possibly damaging 0.79
R8192:Zfp580 UTSW 7 5053115 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GCAGGGAGTGGTATCATCTTCC -3'
(R):5'- AAAGACACGAGCGCACTCTG -3'

Sequencing Primer
(F):5'- GAGTGGTATCATCTTCCTTTTTAGG -3'
(R):5'- TATAGCCCTTGCGAGGACCTG -3'
Posted On2016-12-15