Incidental Mutation 'R5793:Trim68'
ID447073
Institutional Source Beutler Lab
Gene Symbol Trim68
Ensembl Gene ENSMUSG00000073968
Gene Nametripartite motif-containing 68
SynonymsRnf137, F730114J12Rik, SS-56
MMRRC Submission 043208-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5793 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102677582-102687327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102684353 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 41 (S41T)
Ref Sequence ENSEMBL: ENSMUSP00000147991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082175] [ENSMUST00000210855]
Predicted Effect probably benign
Transcript: ENSMUST00000082175
AA Change: S41T

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000080813
Gene: ENSMUSG00000073968
AA Change: S41T

DomainStartEndE-ValueType
RING 16 60 1.61e-8 SMART
BBOX 93 134 9.89e-9 SMART
coiled coil region 187 226 N/A INTRINSIC
PRY 302 354 1.91e-24 SMART
SPRY 355 482 3.03e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210406
Predicted Effect possibly damaging
Transcript: ENSMUST00000210855
AA Change: S41T

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211052
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif-containing protein family, whose members are characterized by a "really interesting new gene" (RING) finger domain, a zinc-binding B-box motif, and a coiled-coil region. Members of this family function as E3 ubiquitin ligases and are involved in a broad range of biological processes. This gene regulates the activation of nuclear receptors, such as androgen receptor, and has been implicated in development of prostate cancer cells, where its expression increases in response to a downregulation of microRNAs. In addition, this gene participates in viral defense regulation as a negative regulator of interferon-beta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12 C A 11: 70,243,053 R522L probably benign Het
Arfgef1 A T 1: 10,209,528 D271E probably benign Het
Arg1 C T 10: 24,920,642 V96M probably benign Het
Arhgap8 T A 15: 84,772,022 M408K probably benign Het
Axin1 T C 17: 26,143,308 S209P probably damaging Het
B4galnt3 A G 6: 120,208,904 probably null Het
BC025446 T C 15: 75,221,644 probably benign Het
BC067074 G T 13: 113,321,022 V1201L possibly damaging Het
Cdh23 T A 10: 60,306,128 D3058V probably damaging Het
Chd9 A G 8: 91,001,756 T794A probably damaging Het
Ckap5 C T 2: 91,619,835 T1891I possibly damaging Het
Dzank1 T C 2: 144,506,224 I207M probably benign Het
Fkbp9 G A 6: 56,873,513 probably null Het
Gm4781 T A 10: 100,396,667 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtpbp6 G A 5: 110,107,228 L33F probably benign Het
Hsd11b1 A C 1: 193,242,184 F27V probably damaging Het
Ift172 A T 5: 31,276,948 I482N possibly damaging Het
Kcnma1 C T 14: 23,309,035 probably null Het
Myh9 T C 15: 77,768,877 Q1420R probably benign Het
Ncam2 G A 16: 81,576,103 V569I possibly damaging Het
Nsd1 T C 13: 55,248,006 V1140A probably benign Het
Ogdhl T A 14: 32,332,773 L226Q probably damaging Het
Olfr645 T C 7: 104,085,030 T17A probably benign Het
Orc2 T C 1: 58,497,388 M1V probably null Het
Padi2 T C 4: 140,933,190 L327P probably benign Het
Palb2 T C 7: 122,127,637 N337D probably benign Het
Pard3b A T 1: 61,767,973 H49L probably damaging Het
Pigz T C 16: 31,945,467 S448P probably benign Het
Ppfia4 A G 1: 134,312,106 V911A probably damaging Het
Qser1 T C 2: 104,762,860 Y1604C probably damaging Het
Rpgrip1l A G 8: 91,260,772 S886P probably benign Het
Sdk2 T C 11: 113,868,952 I408V possibly damaging Het
Sema7a A T 9: 57,960,257 R431W probably damaging Het
Slc22a30 T A 19: 8,336,819 Y501F possibly damaging Het
Slitrk5 T A 14: 111,679,913 V323D probably damaging Het
Snap47 C T 11: 59,438,192 E95K probably damaging Het
Tbc1d9 A T 8: 83,271,440 I1209F probably damaging Het
Tek T A 4: 94,820,096 M297K probably benign Het
Tmem132e T A 11: 82,444,858 I922N probably damaging Het
Tmx2 T C 2: 84,676,157 R64G probably damaging Het
Tsga10 A T 1: 37,835,459 M115K probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r84 C T 10: 130,385,885 C822Y probably damaging Het
Wdr72 C T 9: 74,210,343 A779V probably benign Het
Zfp580 A T 7: 5,052,892 probably benign Het
Zfp772 G A 7: 7,204,284 T136I probably benign Het
Other mutations in Trim68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Trim68 APN 7 102679141 splice site probably null
IGL02703:Trim68 APN 7 102684079 missense probably damaging 0.99
IGL02835:Trim68 UTSW 7 102678573 missense probably benign 0.21
R1765:Trim68 UTSW 7 102680390 missense possibly damaging 0.82
R1780:Trim68 UTSW 7 102684073 missense possibly damaging 0.58
R4107:Trim68 UTSW 7 102678451 missense probably benign 0.01
R4451:Trim68 UTSW 7 102684473 start codon destroyed probably damaging 1.00
R5385:Trim68 UTSW 7 102678783 missense probably damaging 1.00
R5980:Trim68 UTSW 7 102678831 missense probably damaging 1.00
R6749:Trim68 UTSW 7 102678783 missense probably damaging 0.99
R6912:Trim68 UTSW 7 102684468 missense probably damaging 1.00
R7396:Trim68 UTSW 7 102678362 nonsense probably null
R7789:Trim68 UTSW 7 102684469 missense possibly damaging 0.61
R7892:Trim68 UTSW 7 102678797 missense unknown
R8096:Trim68 UTSW 7 102678442 missense probably damaging 1.00
X0067:Trim68 UTSW 7 102684132 missense probably benign 0.00
Z1176:Trim68 UTSW 7 102678813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTTCCTTGTGGAGATCAC -3'
(R):5'- GGAGAACTTACAGTCATTGCCTTC -3'

Sequencing Primer
(F):5'- GGAGATCACACACATCGGTCTTTAG -3'
(R):5'- GAACTTACAGTCATTGCCTTCTTCTC -3'
Posted On2016-12-15