Incidental Mutation 'R5793:Arg1'
ID447080
Institutional Source Beutler Lab
Gene Symbol Arg1
Ensembl Gene ENSMUSG00000019987
Gene Namearginase, liver
SynonymsPGIF, AI, Arg-1
MMRRC Submission 043208-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R5793 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location24915221-24927484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24920642 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 96 (V96M)
Ref Sequence ENSEMBL: ENSMUSP00000020161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020161]
Predicted Effect probably benign
Transcript: ENSMUST00000020161
AA Change: V96M

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020161
Gene: ENSMUSG00000019987
AA Change: V96M

DomainStartEndE-ValueType
Pfam:Arginase 6 305 1.4e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220186
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exist (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type I isoform encoded by this gene, is a cytosolic enzyme and expressed predominantly in the liver as a component of the urea cycle. Inherited deficiency of this enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a null allele show postnatal lethality, hyperammonemia, argininemia, altered plasma levels of other amino acids, enlarged pale livers, and abnormal hepatocytes. Mice homozygous for a different null allele show postnatal lethality, andincreased macrophage nitric oxide production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12 C A 11: 70,243,053 R522L probably benign Het
Arfgef1 A T 1: 10,209,528 D271E probably benign Het
Arhgap8 T A 15: 84,772,022 M408K probably benign Het
Axin1 T C 17: 26,143,308 S209P probably damaging Het
B4galnt3 A G 6: 120,208,904 probably null Het
BC025446 T C 15: 75,221,644 probably benign Het
BC067074 G T 13: 113,321,022 V1201L possibly damaging Het
Cdh23 T A 10: 60,306,128 D3058V probably damaging Het
Chd9 A G 8: 91,001,756 T794A probably damaging Het
Ckap5 C T 2: 91,619,835 T1891I possibly damaging Het
Dzank1 T C 2: 144,506,224 I207M probably benign Het
Fkbp9 G A 6: 56,873,513 probably null Het
Gm4781 T A 10: 100,396,667 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtpbp6 G A 5: 110,107,228 L33F probably benign Het
Hsd11b1 A C 1: 193,242,184 F27V probably damaging Het
Ift172 A T 5: 31,276,948 I482N possibly damaging Het
Kcnma1 C T 14: 23,309,035 probably null Het
Myh9 T C 15: 77,768,877 Q1420R probably benign Het
Ncam2 G A 16: 81,576,103 V569I possibly damaging Het
Nsd1 T C 13: 55,248,006 V1140A probably benign Het
Ogdhl T A 14: 32,332,773 L226Q probably damaging Het
Olfr645 T C 7: 104,085,030 T17A probably benign Het
Orc2 T C 1: 58,497,388 M1V probably null Het
Padi2 T C 4: 140,933,190 L327P probably benign Het
Palb2 T C 7: 122,127,637 N337D probably benign Het
Pard3b A T 1: 61,767,973 H49L probably damaging Het
Pigz T C 16: 31,945,467 S448P probably benign Het
Ppfia4 A G 1: 134,312,106 V911A probably damaging Het
Qser1 T C 2: 104,762,860 Y1604C probably damaging Het
Rpgrip1l A G 8: 91,260,772 S886P probably benign Het
Sdk2 T C 11: 113,868,952 I408V possibly damaging Het
Sema7a A T 9: 57,960,257 R431W probably damaging Het
Slc22a30 T A 19: 8,336,819 Y501F possibly damaging Het
Slitrk5 T A 14: 111,679,913 V323D probably damaging Het
Snap47 C T 11: 59,438,192 E95K probably damaging Het
Tbc1d9 A T 8: 83,271,440 I1209F probably damaging Het
Tek T A 4: 94,820,096 M297K probably benign Het
Tmem132e T A 11: 82,444,858 I922N probably damaging Het
Tmx2 T C 2: 84,676,157 R64G probably damaging Het
Trim68 A T 7: 102,684,353 S41T possibly damaging Het
Tsga10 A T 1: 37,835,459 M115K probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r84 C T 10: 130,385,885 C822Y probably damaging Het
Wdr72 C T 9: 74,210,343 A779V probably benign Het
Zfp580 A T 7: 5,052,892 probably benign Het
Zfp772 G A 7: 7,204,284 T136I probably benign Het
Other mutations in Arg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02011:Arg1 APN 10 24916377 missense probably benign 0.00
IGL02889:Arg1 APN 10 24915755 missense probably damaging 0.98
R0180:Arg1 UTSW 10 24916830 missense probably benign
R0256:Arg1 UTSW 10 24916458 missense probably benign 0.00
R0588:Arg1 UTSW 10 24920624 missense probably damaging 1.00
R1014:Arg1 UTSW 10 24916860 missense probably benign
R1327:Arg1 UTSW 10 24920804 splice site probably null
R1965:Arg1 UTSW 10 24916864 splice site probably null
R2071:Arg1 UTSW 10 24922663 missense probably benign 0.00
R2118:Arg1 UTSW 10 24920723 missense possibly damaging 0.58
R4158:Arg1 UTSW 10 24922677 missense probably damaging 1.00
R4858:Arg1 UTSW 10 24922638 missense possibly damaging 0.73
R5741:Arg1 UTSW 10 24917999 missense probably benign
R7453:Arg1 UTSW 10 24915776 missense probably damaging 1.00
R7634:Arg1 UTSW 10 24915729 missense possibly damaging 0.46
R7760:Arg1 UTSW 10 24927463 start gained probably benign
R7803:Arg1 UTSW 10 24916791 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCCTGAGGAGCTGAAATGTG -3'
(R):5'- TAGAGGGCTGGCTTGTAACC -3'

Sequencing Primer
(F):5'- GGAGCTGAAATGTGAGatatatata -3'
(R):5'- GTAACCTGTTTCTGTCTAGTAACG -3'
Posted On2016-12-15