Incidental Mutation 'R5793:BC025446'
ID447095
Institutional Source Beutler Lab
Gene Symbol BC025446
Ensembl Gene ENSMUSG00000047728
Gene NamecDNA sequence BC025446
Synonyms
MMRRC Submission 043208-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5793 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location75216376-75222661 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 75221644 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055719] [ENSMUST00000185307] [ENSMUST00000229521]
Predicted Effect unknown
Transcript: ENSMUST00000055719
AA Change: S122P
SMART Domains Protein: ENSMUSP00000053396
Gene: ENSMUSG00000047728
AA Change: S122P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 1.06e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185307
SMART Domains Protein: ENSMUSP00000140330
Gene: ENSMUSG00000047728

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 5.3e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229521
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12 C A 11: 70,243,053 R522L probably benign Het
Arfgef1 A T 1: 10,209,528 D271E probably benign Het
Arg1 C T 10: 24,920,642 V96M probably benign Het
Arhgap8 T A 15: 84,772,022 M408K probably benign Het
Axin1 T C 17: 26,143,308 S209P probably damaging Het
B4galnt3 A G 6: 120,208,904 probably null Het
BC067074 G T 13: 113,321,022 V1201L possibly damaging Het
Cdh23 T A 10: 60,306,128 D3058V probably damaging Het
Chd9 A G 8: 91,001,756 T794A probably damaging Het
Ckap5 C T 2: 91,619,835 T1891I possibly damaging Het
Dzank1 T C 2: 144,506,224 I207M probably benign Het
Fkbp9 G A 6: 56,873,513 probably null Het
Gm4781 T A 10: 100,396,667 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtpbp6 G A 5: 110,107,228 L33F probably benign Het
Hsd11b1 A C 1: 193,242,184 F27V probably damaging Het
Ift172 A T 5: 31,276,948 I482N possibly damaging Het
Kcnma1 C T 14: 23,309,035 probably null Het
Myh9 T C 15: 77,768,877 Q1420R probably benign Het
Ncam2 G A 16: 81,576,103 V569I possibly damaging Het
Nsd1 T C 13: 55,248,006 V1140A probably benign Het
Ogdhl T A 14: 32,332,773 L226Q probably damaging Het
Olfr645 T C 7: 104,085,030 T17A probably benign Het
Orc2 T C 1: 58,497,388 M1V probably null Het
Padi2 T C 4: 140,933,190 L327P probably benign Het
Palb2 T C 7: 122,127,637 N337D probably benign Het
Pard3b A T 1: 61,767,973 H49L probably damaging Het
Pigz T C 16: 31,945,467 S448P probably benign Het
Ppfia4 A G 1: 134,312,106 V911A probably damaging Het
Qser1 T C 2: 104,762,860 Y1604C probably damaging Het
Rpgrip1l A G 8: 91,260,772 S886P probably benign Het
Sdk2 T C 11: 113,868,952 I408V possibly damaging Het
Sema7a A T 9: 57,960,257 R431W probably damaging Het
Slc22a30 T A 19: 8,336,819 Y501F possibly damaging Het
Slitrk5 T A 14: 111,679,913 V323D probably damaging Het
Snap47 C T 11: 59,438,192 E95K probably damaging Het
Tbc1d9 A T 8: 83,271,440 I1209F probably damaging Het
Tek T A 4: 94,820,096 M297K probably benign Het
Tmem132e T A 11: 82,444,858 I922N probably damaging Het
Tmx2 T C 2: 84,676,157 R64G probably damaging Het
Trim68 A T 7: 102,684,353 S41T possibly damaging Het
Tsga10 A T 1: 37,835,459 M115K probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r84 C T 10: 130,385,885 C822Y probably damaging Het
Wdr72 C T 9: 74,210,343 A779V probably benign Het
Zfp580 A T 7: 5,052,892 probably benign Het
Zfp772 G A 7: 7,204,284 T136I probably benign Het
Other mutations in BC025446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:BC025446 APN 15 75221656 utr 3 prime probably benign
R0084:BC025446 UTSW 15 75217775 missense probably benign 0.01
R0764:BC025446 UTSW 15 75220723 missense probably benign
R1736:BC025446 UTSW 15 75217720 missense probably damaging 1.00
R1829:BC025446 UTSW 15 75216756 critical splice donor site probably null
R5412:BC025446 UTSW 15 75217820 missense probably damaging 0.98
R7434:BC025446 UTSW 15 75216718 missense probably benign
R8007:BC025446 UTSW 15 75216703 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATTTCCTTCAGGAGCTCATGGC -3'
(R):5'- TTGGCCACATTCCTGGATCC -3'

Sequencing Primer
(F):5'- TGGCTTCACTCTGAGCAAAC -3'
(R):5'- GGATCCTATGCTTGTCCCAGAG -3'
Posted On2016-12-15