Incidental Mutation 'R5794:Serpine2'
ID447103
Institutional Source Beutler Lab
Gene Symbol Serpine2
Ensembl Gene ENSMUSG00000026249
Gene Nameserine (or cysteine) peptidase inhibitor, clade E, member 2
Synonymsprotease nexin 1, Spi4, B230326M24Rik, nexin, PN-1, PI7
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location79794197-79861180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79821439 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 33 (N33D)
Ref Sequence ENSEMBL: ENSMUSP00000140255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027467] [ENSMUST00000189793] [ENSMUST00000190724]
Predicted Effect probably benign
Transcript: ENSMUST00000027467
AA Change: N33D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027467
Gene: ENSMUSG00000026249
AA Change: N33D

DomainStartEndE-ValueType
SERPIN 36 397 9.93e-152 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153862
Predicted Effect probably benign
Transcript: ENSMUST00000189793
SMART Domains Protein: ENSMUSP00000140065
Gene: ENSMUSG00000026249

DomainStartEndE-ValueType
SERPIN 1 231 2.3e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190724
AA Change: N33D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140255
Gene: ENSMUSG00000026249
AA Change: N33D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 36 232 7.1e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191529
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. Thrombin, urokinase, plasmin and trypsin are among the proteases that this family member can inhibit. This gene is a susceptibility gene for chronic obstructive pulmonary disease and for emphysema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene are viable and healthy but develop epileptic activity as well as reduced theta burst-induced LTP and NMDA receptor-mediated synaptic transmission in the CA1 field of the hippocampus; notably, homozygous mutant males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Serpine2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Serpine2 APN 1 79810694 missense probably damaging 0.98
IGL01386:Serpine2 APN 1 79801551 missense probably damaging 0.97
IGL02069:Serpine2 APN 1 79821412 missense possibly damaging 0.94
IGL02516:Serpine2 APN 1 79794997 unclassified probably benign
IGL02743:Serpine2 APN 1 79801555 missense probably damaging 1.00
R0372:Serpine2 UTSW 1 79821430 missense probably damaging 0.98
R1519:Serpine2 UTSW 1 79795031 missense probably damaging 1.00
R1768:Serpine2 UTSW 1 79816815 missense probably damaging 1.00
R1993:Serpine2 UTSW 1 79821442 missense probably damaging 1.00
R1995:Serpine2 UTSW 1 79821442 missense probably damaging 1.00
R2034:Serpine2 UTSW 1 79796852 missense probably damaging 1.00
R2094:Serpine2 UTSW 1 79810694 missense probably damaging 0.98
R2311:Serpine2 UTSW 1 79810548 splice site probably benign
R2312:Serpine2 UTSW 1 79802853 missense probably damaging 1.00
R2519:Serpine2 UTSW 1 79799539 missense possibly damaging 0.55
R4844:Serpine2 UTSW 1 79799524 nonsense probably null
R5141:Serpine2 UTSW 1 79802863 missense possibly damaging 0.92
R5386:Serpine2 UTSW 1 79821287 nonsense probably null
R5422:Serpine2 UTSW 1 79816875 missense probably benign 0.03
R5422:Serpine2 UTSW 1 79821489 missense probably benign 0.10
R5786:Serpine2 UTSW 1 79816920 missense probably benign 0.02
R6109:Serpine2 UTSW 1 79810671 missense probably damaging 1.00
R6514:Serpine2 UTSW 1 79821570 splice site probably null
R6544:Serpine2 UTSW 1 79803130 intron probably null
R7001:Serpine2 UTSW 1 79795031 missense probably damaging 1.00
R7395:Serpine2 UTSW 1 79801555 missense probably damaging 1.00
R7660:Serpine2 UTSW 1 79802905 missense probably benign 0.07
R7844:Serpine2 UTSW 1 79816799 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGATGATGACCCTTCGCC -3'
(R):5'- GGCACAGTGTACTCATCCTTTG -3'

Sequencing Primer
(F):5'- ATGATGACCCTTCGCCTGCAG -3'
(R):5'- TCCTTGTTGGAAGGAACC -3'
Posted On2016-12-15