Incidental Mutation 'R5794:Ece1'
ID447112
Institutional Source Beutler Lab
Gene Symbol Ece1
Ensembl Gene ENSMUSG00000057530
Gene Nameendothelin converting enzyme 1
Synonyms
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location137862237-137965229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137956533 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 565 (I565M)
Ref Sequence ENSEMBL: ENSMUSP00000099576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102518]
Predicted Effect probably damaging
Transcript: ENSMUST00000102518
AA Change: I565M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099576
Gene: ENSMUSG00000057530
AA Change: I565M

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:Peptidase_M13_N 105 490 1.2e-112 PFAM
Pfam:Peptidase_M13 549 752 1.8e-77 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations show cardiac and craniofacial abnormalities and embryonic mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Ece1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Ece1 APN 4 137938658 missense probably damaging 1.00
IGL01538:Ece1 APN 4 137948544 missense probably benign
IGL01588:Ece1 APN 4 137957206 splice site probably benign
IGL01678:Ece1 APN 4 137962733 missense probably damaging 1.00
IGL02619:Ece1 APN 4 137938733 missense probably benign 0.08
IGL02936:Ece1 APN 4 137946301 missense probably benign 0.01
IGL02956:Ece1 APN 4 137962838 missense probably damaging 0.99
IGL03332:Ece1 APN 4 137946355 missense probably damaging 0.99
R0063:Ece1 UTSW 4 137948581 missense probably benign 0.14
R0240:Ece1 UTSW 4 137949435 splice site probably benign
R1004:Ece1 UTSW 4 137926239 missense probably benign 0.04
R1515:Ece1 UTSW 4 137951508 missense probably benign 0.00
R1541:Ece1 UTSW 4 137948660 splice site probably null
R1796:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1834:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1834:Ece1 UTSW 4 137958128 missense probably damaging 0.99
R1836:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1930:Ece1 UTSW 4 137938763 missense probably benign 0.01
R1931:Ece1 UTSW 4 137938763 missense probably benign 0.01
R2065:Ece1 UTSW 4 137958082 missense probably benign 0.04
R2281:Ece1 UTSW 4 137946362 missense possibly damaging 0.93
R3118:Ece1 UTSW 4 137948544 missense probably benign
R4720:Ece1 UTSW 4 137957175 missense probably damaging 1.00
R4773:Ece1 UTSW 4 137945153 missense probably benign 0.00
R5969:Ece1 UTSW 4 137961740 critical splice donor site probably null
R6056:Ece1 UTSW 4 137961647 missense probably damaging 1.00
R6332:Ece1 UTSW 4 137958008 missense probably damaging 1.00
R6648:Ece1 UTSW 4 137921159 missense probably benign 0.00
R7285:Ece1 UTSW 4 137913763 splice site probably null
R7387:Ece1 UTSW 4 137938784 missense possibly damaging 0.69
R8103:Ece1 UTSW 4 137913822 missense probably benign
R8294:Ece1 UTSW 4 137948620 missense possibly damaging 0.60
R8308:Ece1 UTSW 4 137936764 missense probably damaging 0.99
X0063:Ece1 UTSW 4 137926375 missense probably damaging 0.97
Z1176:Ece1 UTSW 4 137921027 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GGCACTCAGATGTGTGACTG -3'
(R):5'- AACTCCAGGCCTTCTAGGTC -3'

Sequencing Primer
(F):5'- GAATTGAACCCAGGGCTTTGTAC -3'
(R):5'- GCCTTCTAGGTCTGGGCAC -3'
Posted On2016-12-15