Incidental Mutation 'R5794:Tapt1'
ID447114
Institutional Source Beutler Lab
Gene Symbol Tapt1
Ensembl Gene ENSMUSG00000046985
Gene Nametransmembrane anterior posterior transformation 1
Synonyms
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location44175154-44226626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44177134 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 505 (G505D)
Ref Sequence ENSEMBL: ENSMUSP00000062110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055128] [ENSMUST00000199374]
Predicted Effect probably benign
Transcript: ENSMUST00000055128
AA Change: G505D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062110
Gene: ENSMUSG00000046985
AA Change: G505D

DomainStartEndE-ValueType
low complexity region 6 43 N/A INTRINSIC
low complexity region 54 62 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
Pfam:DUF747 152 456 8.9e-112 PFAM
low complexity region 473 489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198388
Predicted Effect probably benign
Transcript: ENSMUST00000199374
SMART Domains Protein: ENSMUSP00000143625
Gene: ENSMUSG00000046985

DomainStartEndE-ValueType
low complexity region 6 43 N/A INTRINSIC
low complexity region 54 62 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein that localizes to the centrosome and/or ciliary basal body. Mutations in this gene disrupt Golgi morphology and trafficking and normal primary cilium formation and these mutations are congenitally manifested by severe undermineralization of the intra-uterine skeleton. A mutation in the mouse ortholog of this gene results in homeotic, posterior-to-anterior transformations of the axial skeleton which are similar to the phenotype of mouse homeobox C8 gene mutants. In mouse, this gene is thought to function downstream of homeobox C8 to transduce extracellular patterning information during axial skeleton development. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for an ENU mutation causing a truncation exhibit vertebral trasnformations and defects in rib attachment and the xiphoid process. Mice homozygous for a transgenic gene disruption exhibit cleft palate and possible anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Tapt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Tapt1 APN 5 44178990 missense probably damaging 1.00
IGL03011:Tapt1 APN 5 44193187 missense possibly damaging 0.58
IGL03018:Tapt1 APN 5 44204324 missense probably damaging 1.00
R0385:Tapt1 UTSW 5 44218101 splice site probably null
R0624:Tapt1 UTSW 5 44177106 missense possibly damaging 0.81
R1491:Tapt1 UTSW 5 44218102 critical splice donor site probably null
R2423:Tapt1 UTSW 5 44192453 missense probably benign 0.08
R4175:Tapt1 UTSW 5 44177105 missense probably benign 0.02
R7344:Tapt1 UTSW 5 44188657 missense probably damaging 1.00
R7355:Tapt1 UTSW 5 44177117 missense probably benign
R7464:Tapt1 UTSW 5 44188688 nonsense probably null
R7491:Tapt1 UTSW 5 44188636 missense probably damaging 1.00
R8085:Tapt1 UTSW 5 44178965 missense probably damaging 1.00
X0062:Tapt1 UTSW 5 44194357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTCCCGCAAATTGTGAACC -3'
(R):5'- GGATAAACAGTGTGTGACTAGCTTC -3'

Sequencing Primer
(F):5'- CGCAAATTGTGAACCTGTCTATTTC -3'
(R):5'- TGTAAATGACAGCTTATACAGTATGC -3'
Posted On2016-12-15